User: Sarthok

gravatar for Sarthok
New User
Pennsylvania State University
Last seen:
1 year, 10 months ago
2 years, 10 months ago

I am a PhD student at Penn State University, started in Spring 2016.

Posts by Sarthok

<prev • 10 results • page 1 of 1 • next >
Answer: A: How should the data be formatted to run an association mapping in PLINK?
... I have done similar analysis using plink 1.9. From your phenotype file as I can see in the sex column all values has to be numeric. If you are using a mac book to create the txt file please make sure you save (as) the file as UTF-8 (no BOM) because text file created in classic mac encoding does not ...
written 2.2 years ago by Sarthok60
Answer: A: Missing BWA alignment score (AS) tag in SAM files
... Please see this and [this][1] and the [related post.][2] Using the bwa mem sould generate the AS score. I have just tested it by aligning PE reads with a reference genome and output is like this: SRR1972739.3 131 AF086833 2587 60 81M20S = 2531 -57 GAATGATGAGAATAGATTTGTTACACTGGATGGTCAACAATTTTATTGGC ...
written 2.4 years ago by Sarthok60
Comment: C: De novo genome assembly of haploid genome
... I have gone through the [MIRA manual][1] (which is extremely helpful) to write and tune my parameters. It completely depends on your data type (read type, template size etc) and what kind of assembly you expect to generate (draft/accurate, de novo/ reference based) . Here is one of the parameters I ...
written 2.4 years ago by Sarthok60
GWAS with haploid Genome Dataset
... I am going to conduct a Genome Wide Association Study using bumblebee genome data and I am planning to use PLINK for that. Due to haplodiploidic nature of the sex determination system of the species(bumblebee) the males are haploid and females are diploid. However, I am dealing with genome datasets ...
gwas haploid plink association mapping written 2.7 years ago by Sarthok60
Annotating non-coding DNA (CRM): TF binding site analysis
... Hello, I am trying to annotate a ~300KB region from a insect genome which is a non-protein coding/ cis-regulatory region. I am primarily interested to identify all transcription factor binding sites. I have found lots of web based programs but not sure which one would be best fit for a insect geno ...
tf binding site R non-coding sequence written 2.8 years ago by Sarthok60 • updated 2.8 years ago by natasha.sernova3.4k
Answer: A: De novo genome assembly of haploid genome
... I went with MIRA and experimented with several parameters. I got a assembly which had N50 value of 50KB and blast results provided the contigs for the region I am interested in. Thanks all for your help! ...
written 2.8 years ago by Sarthok60
Comment: C: De novo genome assembly of haploid genome
... Hi Rohit, We have done a reference based assembly (aligning with the published genome of a closely related species- the paper Philipp mentioned, Bombus impatiens) but we are now are trying to identify some (possible) novel variation in a specific part of the genome (300 KB region) as that's why we ...
written 2.9 years ago by Sarthok60
Comment: C: De novo genome assembly of haploid genome
... Hi Philipp, We have only paired end library data with 150 bp insert size. The bumblebee genome people had 454 libraries and mate- pair so I guess our choice of assembler would vary from them. ...
written 2.9 years ago by Sarthok60
Comment: C: De novo genome assembly of haploid genome
... The data is from Illumina Hi seq, it's paired end and the insert size is 150 bp. ...
written 2.9 years ago by Sarthok60
De novo genome assembly of haploid genome
... I am planning to conduct de novo assembly of a bumblebee species and it is haploid. I was wondering what assembler would be best for it? I am considering platanus, megahit and hapsembler at this moment. Thanks for your help! ...
genome assembly written 2.9 years ago by Sarthok60 • updated 2.5 years ago by Biostar ♦♦ 20

Latest awards to Sarthok

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2180 users visited in the last hour