User: angrypigeon

gravatar for angrypigeon
angrypigeon120
Reputation:
120
Status:
Trusted
Location:
Last seen:
8 hours ago
Joined:
2 years, 4 months ago
Email:
s*****@gmail.com

Posts by angrypigeon

<prev • 61 results • page 1 of 7 • next >
6
votes
3
answers
207
views
6 follow
3
answers
Get gene names from ensembl ID or gene region
... I have some RNASeq data that has fpkm values labeled with genome positions like `chr7 52823165 52830546` Ensembl IDs like `ENSMUST00000143813` and gene symbols like `0610005C13Rik`. Is there a good programmatic way in python to get gene names from any of this data so I can match up the fpkm values w ...
ensembl rna-seq python written 11 days ago by angrypigeon120 • updated 10 days ago by Alex Reynolds25k
0
votes
2
answers
185
views
2
answers
Comment: C: Label fastq reads
... Right, I was thinking that there might be a way to track this information in an associated file, but if I am doing this pre-alignment, I do not know how to associate the read information with output variants. ...
written 3 months ago by angrypigeon120
0
votes
2
answers
185
views
2
answers
Comment: C: Label fastq reads
... The goal is a bit complicated, but essentially I have barcoded fastq reads that I am binning together and using for consensus sequence derivation. I would like to retain parts of the information in the binned reads such as percent sequence agreement at each position. Then I would be using this infor ...
written 3 months ago by angrypigeon120
1
vote
2
answers
185
views
2
answers
Label fastq reads
... I am deriving some sequencing consensus reads from fastq files, and I would like to keep track of some information during the derivation process, and I'm wondering if there is a good way to do this. To simplify the problem if I have a fastq file with the following read in it, I want to associate som ...
alignment sequencing written 3 months ago by angrypigeon120 • updated 3 months ago by swbarnes24.0k
0
votes
0
answers
185
views
0
answers
Comment: C: Samtools faidx non-zero exit status 217
... Yeah samtools does appear to be working fine. I'll try building a new reference and see if this helps. ...
written 4 months ago by angrypigeon120
2
votes
0
answers
185
views
0
answers
Samtools faidx non-zero exit status 217
... I have been using something like `samtools faidx hg19.fa chr1:115227843-115227863` to extract sequence for specified locations. However, for the particular command above I am getting: `Command 'samtools faidx hg19.fa chr1:115227843-115227863' returned non-zero exit status 127`. Am I doing something ...
sequence written 4 months ago by angrypigeon120
0
votes
0
answers
214
views
0
answers
Comment: C: Determining off-target oligo binding potential
... Right, and I am looking for the best way of doing this that will output useful information like Gibb's free energy of binding association which can be helpful to understand the specificity of a particular probe. ...
written 5 months ago by angrypigeon120
0
votes
0
answers
214
views
0
answers
Determining off-target oligo binding potential
... I am building a probeset of oligos for targeted gDNA capture that will be used for sequencing. The idea is fundamentally similar to primer design, where I am building a panel consisting of targeting arms that bind specific loci in order to capture specified genomic regions. I am using primer3-py fo ...
genome sequence sequencing written 5 months ago by angrypigeon120
3
votes
1
answer
431
views
1
answer
primer3-py Heterodimer Calculations
... I am trying to put together a panel of oligo probes, and I am using primer3-py to design oligos to specific criteria and then ask if they are a good pair. One way I am doing this is asking how much two oligos heterodimerize. import primer3 primer3.calcHeterodimer('TCAACGTGGAATGTGCCCTGGTAGC ...
sequence sequencing written 6 months ago by angrypigeon120 • updated 6 months ago by skbrimer500
1
vote
0
answers
468
views
0
answers
Use vcf files for dN/dS calculations
... I am trying to run a dN/dS calculation on some sequencing data of mine to understand positive and negative selection presence across different variants. Using my vcf files I was thinking of doing something like: `samtools faidx ref chrom:low-high'` to get a triplet context, and then make further cal ...
sequencing written 8 months ago by angrypigeon120

Latest awards to angrypigeon

Popular Question 3 months ago, created a question with more than 1,000 views. For Reason for Freebayes Calling Multi-base Variants
Popular Question 3 months ago, created a question with more than 1,000 views. For Converting Illumina fastq quality scores to phred
Popular Question 3 months ago, created a question with more than 1,000 views. For Lollipop Plot of Variant Locations
Teacher 8 months ago, created an answer with at least 3 up-votes. For A: Converting Illumina fastq quality scores to phred
Popular Question 13 months ago, created a question with more than 1,000 views. For Converting Illumina fastq quality scores to phred
Scholar 21 months ago, created an answer that has been accepted. For A: Running bcbio.rnaseq with correct formula
Scholar 24 months ago, created an answer that has been accepted. For A: Running bcbio.rnaseq with correct formula

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1039 users visited in the last hour