User: Eskimo

gravatar for Eskimo
Eskimo60
Reputation:
60
Status:
New User
Location:
Last seen:
3 weeks, 4 days ago
Joined:
2 years ago
Email:
d*********@ucl.ac.uk

Posts by Eskimo

<prev • 6 results • page 1 of 1 • next >
4
votes
1
answer
108
views
1
answers
Answer: A: highlighting specific genes (from a user-supplied list) in a Volcano plot in R
... As always seems to be the case, I figured out the answer five minutes after asking the question... with(res, plot(log2FoldChange, -log10(pvalue), pch=16, cex=0.6, main="Volcano plot", xlim=c(-5,5))) gene_list <- scan("genelist.txt", what="", sep="\n") gene_list <- as.vector(gene_ ...
written 4 weeks ago by Eskimo60
4
votes
1
answer
108
views
1
answer
highlighting specific genes (from a user-supplied list) in a Volcano plot in R
... I've generated a volcano plot using DeSeq2 results and would like to specifically highlight a subset of genes by providing a list of gene IDs Dataset$condition <- relevel(Dataset$condition, "Ctrl") res <- lfcShrink(DatasetProcessed, contrast=c("condition","Treat","Ctrl")) with(re ...
R deseq2 volcano plot written 4 weeks ago by Eskimo60
1
vote
2
answers
734
views
2
answers
Answer: A: Sequence Dereplication and Database Curator Program (SDDC)
... This is a really nice little program to play around with and I am finding lots of interesting uses for it. However, I am wondering if you could modify it to include a count function so that the number of duplicates of each sequence could be included in the fasta header for a given sequence? Can y ...
written 3 months ago by Eskimo60
0
votes
0
answers
266
views
0
answers
Differential Gene Expression Analysis using two distinct scRNA-seq datasets
... I have two distinct scRNA-seq datasets, both generated from a heterogeneous population of cells. One sample has been treated with a drug, the other has not. My aim is to identify the distinct cellular subtypes present and then to perform differential expression analysis to identify genes that are ...
scrna-seq differential gene expression rna-seq written 6 months ago by Eskimo60
0
votes
3
answers
1.0k
views
3
answers
Answer: A: Extracting and joining exons from multiple sequence alignments using PERL
... Hi folks, thanks for the answers so far. I just want to clarify my question a little further. Assume my multiple sequence alignment looks like this >genomeA ACTCGAGCTATCGATCGATCATGCGAGCGCTACTAAATTTCATCGAGCGTATTCTATCTGAGCTAGCATCTTCA >genomeB ACTCGAGCTATCGATCGATCATGCG---GCTACTATCTCATTCATCGAG ...
written 2.1 years ago by Eskimo60
1
vote
3
answers
1.0k
views
3
answers
Extracting and joining exons from multiple sequence alignments using PERL
... Hi all, I would really appreciate any help you can provide with the following coding problem (using PERL). I have an aligned multiple sequence alignment (fasta format) as my input, along with a file containing the co-ordinates of all open reading frames (ORFs) and the exons that make them up, I am ...
perl fasta multiple sequence alignment exons written 2.1 years ago by Eskimo60

Latest awards to Eskimo

Teacher 4 weeks ago, created an answer with at least 3 up-votes. For A: highlighting specific genes (from a user-supplied list) in a Volcano plot in R
Scholar 4 weeks ago, created an answer that has been accepted. For A: Sequence Dereplication and Database Curator Program (SDDC)
Scholar 3 months ago, created an answer that has been accepted. For A: Sequence Dereplication and Database Curator Program (SDDC)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 878 users visited in the last hour