User: Pawan Jayaswal

Reputation:
0
Status:
New User
Last seen:
1 year, 3 months ago
Joined:
7 years, 11 months ago
Email:
e***************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Pawan Jayaswal

<prev • 3 results • page 1 of 1 • next >
0
votes
0
answers
1.6k
views
0
answers
Estimation of divergence time between organism on the synonymous substituion(Ks)
... I would like to know how to estimate the divergence time on the basis of synonymous substituion(Ks) value. As fas as I know for this I have followed the muse clock (=Ks/2D, where Ks : Synonymous substituion and D is  synonamous mutation rate/year), here my question is how to know the value of D.  Is ...
gene genome alignment sequencing written 4.3 years ago by Pawan Jayaswal0 • updated 3.1 years ago by Biostar ♦♦ 20
0
votes
1
answer
1.5k
views
1
answers
Comment: C: Extraction Of Part Of Different Grp Of Nucleotide Sequence In 10000 Of Sequences
... I would like to elaborate it.... contig00001 length=24020 numreads=1501 TCCTTAAGAATGTCTTCAATACAATCTTTTTGGATTGATTTTGTCAAATCAACCAGGAAA TTTTCCATGTCTTCCAAACCTTGCTCTACAAAGATTATTTTTCCAATGAACAACATCAGC CTTGATACCCACTTCATATGATGAGATTCTGTTATCAAAATTATACTTACCTTGCAAATA TGATGTGAATTTTTTGTGTTGTGATTCACCA ...
written 8.0 years ago by Pawan Jayaswal0
2
votes
1
answer
1.5k
views
1
answer
Extraction Of Part Of Different Grp Of Nucleotide Sequence In 10000 Of Sequences.
... Hi I would like to extract particular reason in the 1000 contigs.For example I am having 10000 sequences as a contig and each sequence file having 5000 nucleotide base pair. Suppose contig one is having 1000 base pair and i want to extract 1-200 , 251-456, 500-609 and others so in this way I am hav ...
extraction sequence written 8.0 years ago by Pawan Jayaswal0 • updated 7.8 years ago by Ido Tamir5.0k

Latest awards to Pawan Jayaswal

Popular Question 2.2 years ago, created a question with more than 1,000 views. For Estimation of divergence time between organism on the synonymous substituion(Ks)
Popular Question 4.3 years ago, created a question with more than 1,000 views. For Extraction Of Part Of Different Grp Of Nucleotide Sequence In 10000 Of Sequences.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1928 users visited in the last hour