User: bulbul

gravatar for bulbul
New User
Last seen:
1 year, 11 months ago
4 years, 4 months ago

Posts by bulbul

<prev • 9 results • page 1 of 1 • next >
binary tp nucleotide convertion
... How to convert DArT file containing binary (0, 1) into AT,GC format. Kindly suggest it ...
nucleotide gwas binary snp written 23 months ago by bulbul10
(Closed) Conversion of binary to ATGC
... CloneID Sequence CloneID P1 P2 1 2 3 4 11061 TCGCTGTACACTGTTGACGTCGCC 11061 1 1 1 1 1 1 11294 AAAGGTTCTATCTCGCTGAAACCCAG 11294 0 1 1 1 1 1 22912 ACCATCGCTGCACCACCTTGACCT 22912 1 - 1 1 1 1 11324 AGCAGCGTCGACTGCCGAGATCGG ...
gwas dart snp written 23 months ago by bulbul10 • updated 23 months ago by zx87549.6k
Comment: C: conversion binary to ATGC
... "0" = Reference allele homozygote, "1"= SNP allele homozygote, "-" = missing. But I do not know to to convert the above example data into AT GC AA CC like. kindly suggest me. thank you. ...
written 23 months ago by bulbul10
conversion binary to ATGC
... CloneID Sequence CloneID P1 P2 1 2 3 4 11061 TCGCTGTACACTGTTGACGTCGCC 11061 1 1 1 1 1 1 11294 AAAGGTTCTATCTCGCTGAAACCCAG 11294 0 1 1 1 1 1 22912 ACCATCGCTGCACCACCTTGACCT 22912 1 - 1 1 1 1 11324 AGCAGCGTCGACTGCCGAGATCGG ...
gwas snp written 23 months ago by bulbul10 • updated 23 months ago by lakhujanivijay5.2k
Find chromosome number
... How to find out the chromosome position of each sequence of the sample? Thanks in advance Sequence CloneID Chromosome ChromosomePosition TGCAGTTATTTGGCTCATCGTCGTATTGCAAGTTTCTGACATCGCTGTACACTGTTGACGTCGCCGAGA 1106145|F|0 contig103705_ln_2374_nr_121_ 2005 TGCAGGGCCGCCATGCCACCGAGTCTGGCGTG ...
perl R chromosome written 23 months ago by bulbul10 • updated 23 months ago by rse90
furious-luke/lizards-are-awesome package for ubuntu
... I have install docker and python which are dependent tools as these are dependent tools. Can any body tell me how to install **furious-luke/lizards-are-awesome** in Ubuntu as i tried through the instruction on I dont know how to install **furious- ...
gwas python docker linux written 23 months ago by bulbul10
Comment: C: Searching Fasta File For Specific Ids
... how shoulld i pull out the mutiple sequences from one fasta file by using gene id header in another text file?? what is command use in linux? ...
written 4.3 years ago by bulbul10
perl programming for finding sequenc
... I have a de novo assembly file "denovo.fasta", and another file with 25,000 genes id "gene_id.txt". how should i retrive those sequences from the "denovo.fasta" which are only present in "gene_id.txt" file? ...
assembly rna-seq written 4.4 years ago by bulbul10 • updated 4.3 years ago by JC11k
find all the genes present in all files
... i have six files. each file have lakhs of gene_id. i have to find out all the genes that are present in all file. if any gene(s) is/are not present even in a single file. then i have to delete them. how should i do it?? ...
perl written 4.4 years ago by bulbul10 • updated 4.4 years ago by natasha.sernova3.7k

Latest awards to bulbul

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1128 users visited in the last hour