User: mforthman

gravatar for mforthman
mforthman30
Reputation:
30
Status:
New User
Location:
Last seen:
10 months, 1 week ago
Joined:
2 years, 10 months ago
Email:
m********@ufl.edu

Posts by mforthman

<prev • 48 results • page 1 of 5 • next >
0
votes
0
answers
427
views
0
answers
prinseq error: Use of uninitialized value $qual in scalar chomp
... Running fastq-generated SRA files from NCBI through prinseq-lite. The program generates an error: Use of uninitialized value $qual in scalar chomp at /apps/prinseq/0.20.4/bin/prinseq-lite.pl line 2583, line 26875674. It still continues on until it has finished, but clearly there is somethin ...
software error prinseq sequence written 10 months ago by mforthman30
1
vote
2
answers
349
views
2
answers
using NCBI SRA data for prinseq
... I have been trying to download SRA data from NCBI and putting it in fastq format using fastq-dump. A colleague and I have been trying to figure out why the resulting fastq files are causing some errors when inputted into prinseq-lite. My collaborator has been using this fastq-dump command: fas ...
software error sra fastq sequence prinseq written 10 months ago by mforthman30 • updated 10 months ago by swbarnes25.0k
0
votes
4
answers
1.0k
views
4
answers
Comment: C: search text in one file and then replace with text from another file
... I've still been tinkering with the script and feel as though I might be getting closer to the solution: #!/usr/bin/env python import sys import re original_fn = sys.argv[1] company_fn = sys.argv[2] pattern = '(uce.+$|ENSOFAS.+$|[AB]_[0-9]+$)' map = {} ...
written 16 months ago by mforthman30
1
vote
4
answers
1.0k
views
4
answers
Comment: C: search text in one file and then replace with text from another file
... You are correct, that was my mistake. Thanks for catching that! And I appreciate you taking a further look at this later. ...
written 16 months ago by mforthman30
0
votes
4
answers
1.0k
views
4
answers
Comment: C: search text in one file and then replace with text from another file
... Correct, I kept the original question simple in original post. In reality, the company.fasta file had many differently formatted headers. I used the script you had provided to process just the `uce` headers, which worked. I already had the `ENSOFAS` headers. This leaves the others to be formatted. T ...
written 16 months ago by mforthman30
0
votes
4
answers
1.0k
views
4
answers
Comment: C: search text in one file and then replace with text from another file
... Thanks for the info. I've modified the regex pattern to also skip over other headers that shouldn't be modified, e.g., like the ones in the original posting (they are all in one file). If I tested correctly, the new pattern is `(uce | ENSOFAS | _[AB]_[0-9]+$)`. Regarding the last part of your reply, ...
written 16 months ago by mforthman30
0
votes
4
answers
1.0k
views
4
answers
Comment: C: search text in one file and then replace with text from another file
... How might this script be modified to deal with other headers that are formatted differently in the company.fasta file? Specifically, I'm targeting the following example headers now: >Clavigralla_tomentosicollis_gi_512427358_gb_GAJX01007276.1_0_rc TGAGAAGCTCTCGCAGTCACACTGGCCCACGACCACTCTCA ...
written 16 months ago by mforthman30
0
votes
0
answers
519
views
0
answers
search text in one file and then replace with text from another file PART 2
... I had a similar situation posted [here][1], which was resolved, but I'm now dealing with differently formatted headers. I have two DNA sequence files I'm working with. One file (e.g., 'company.fasta') has headers that I need to change based on corresponding headers from another file (e.g., 'original ...
search replace python written 17 months ago by mforthman30 • updated 15 months ago by Biostar ♦♦ 20
0
votes
4
answers
1.0k
views
4
answers
Comment: C: search text in one file and then replace with text from another file
... PERFECT! Thank you and everyone else for all of your help. ...
written 17 months ago by mforthman30
0
votes
4
answers
1.0k
views
4
answers
Comment: C: search text in one file and then replace with text from another file
... Example original headers from one dataset source: >uce-2015_p10 |design:hemiptera-v1,designer:faircloth,probes-locus:uce-2015,probes-probe:10,probes-source:oncfas1,probes-global-chromo:Scaffold80,probes-global-start:539805,probes-global-end:539925,probes-local-start:40,probes-local-end:160 ...
written 17 months ago by mforthman30

Latest awards to mforthman

Popular Question 2.6 years ago, created a question with more than 1,000 views. For How to extract exon sequences from annotated genome
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Reciprocal Best Hits across more than 2 species

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 884 users visited in the last hour