User: candida.vaz

gravatar for candida.vaz
Reputation:
0
Status:
New User
Last seen:
11 months ago
Joined:
2 years, 6 months ago
Email:
c**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by candida.vaz

<prev • 16 results • page 1 of 2 • next >
0
votes
0
answers
465
views
0
answers
Comment: C: optimizing the -r/--mate-inner-dist in Tophat2
... I have also used STAR aligner for mapping. Thanks for the information, will look up the publication you suggested. ...
written 12 months ago by candida.vaz0
0
votes
0
answers
465
views
0
answers
optimizing the -r/--mate-inner-dist in Tophat2
... Hello everyone, I have Illumina paired end (2*150bp) reads for 30 samples that I mapped to the reference genome using Tophat2. The sequencing providers gave me the following information: - The fragments used for sequencing range from 200 to 400bp - The average size is around 303 to 330bp. This inc ...
tophat2 rna-seq written 12 months ago by candida.vaz0
0
votes
1
answer
1.8k
views
1
answers
Comment: C: Using STAR aligner output for Htseq-count and Cufflinks
... Hello Devon, Thanks for your answer! I was wondering what is feature count? I am using Htseq-count. http://www-huber.embl.de/HTSeq/doc/count.html While running STAR **--outSAMtype BAM Unsorted SortedByCoordinate** we get two BAM files STAR manual recommends to use the output **Unsorted bam** file ...
written 18 months ago by candida.vaz0
3
votes
1
answer
1.8k
views
1
answer
Using STAR aligner output for Htseq-count and Cufflinks
... Dear All, I am using STAR aligner for mapping my paired end reads using the following parameters: /cluster/apps/x86_64/packages/STAR_2.5/bin/STAR --runThreadN 4 --genomeDir /home/candidav/STAR-Gallus-gallus-nv5/Gallus-gallus-genome-dir-nv5 --readFilesIn /home/candidav/S1/RCI001-forward_paired.fas ...
rna-seq written 18 months ago by candida.vaz0 • updated 18 months ago by Devon Ryan86k
2
votes
1
answer
964
views
1
answer
Trimmomatic : keepBothReads True vs False option
... Hello everyone, Is anyone familiar with the **"keepBothReads"** in **Trimmomatic** : **keepBothReads:** After read-through has been detected by palindrome mode, and the adapter sequence removed, the reverse read contains the same sequence information as the forward read, albeit in reverse complem ...
rna-seq written 19 months ago by candida.vaz0 • updated 19 months ago by Brian Bushnell16k
0
votes
1
answer
6.3k
views
1
answers
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... https://support.illumina.com/bulletins/2016/12/what-sequences-do-i-use-for-adapter-trimming.html ...
written 19 months ago by candida.vaz0
0
votes
1
answer
6.3k
views
1
answers
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... Oh I see! But did you check your R1 and R2 files for the presence of the adapters mentioned by Illumina. My only issue is the sequence mentioned in the trimmomatic adapter file as 2 is actually for R1 and vice versa. ...
written 19 months ago by candida.vaz0
0
votes
1
answer
6.3k
views
1
answers
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... Hi Macspider, Could you please share the adapter file you used for removing adapters from Truseq PE data using Trimmomatic. Was your file similar to mine or did you use the "TruSeq3-PE-2.fa". Though the sequences and their reverse complements are the same, but if you notice, they are for opposite ...
written 19 months ago by candida.vaz0
0
votes
1
answer
6.3k
views
1
answers
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... So did you have the "TACACTCTTTCCCTACACGACGCTCTTCCGATCT" adapter seq in your R1 file and "GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT" seq in your R2 file? Could you check taking the top 200~ sequences of both your files ...
written 19 months ago by candida.vaz0
0
votes
1
answer
6.3k
views
1
answers
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... Yes it is also mentioned in the manual that one needs to mention the reverse complement. My doubt is regarding the universal usage of the Trimmomatic provided adapter file "TruSeq3-PE-2.fa". Should this file be used always? Or was I right in making my own file according to the adapters in my file. ...
written 19 months ago by candida.vaz0

Latest awards to candida.vaz

Autobiographer 12 months ago, has more than 80 characters in the information field of the user's profile.
Popular Question 17 months ago, created a question with more than 1,000 views. For Trimmomatic adapter file TruSeq3-PE-2.fa

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1013 users visited in the last hour