User: candida.vaz

gravatar for candida.vaz
New User
Last seen:
1 year, 4 months ago
4 years, 7 months ago

I am a Research Scientist at the Bioinformatics Institute, A*STAR, Singapore.

Posts by candida.vaz

<prev • 16 results • page 1 of 2 • next >
Comment: C: optimizing the -r/--mate-inner-dist in Tophat2
... I have also used STAR aligner for mapping. Thanks for the information, will look up the publication you suggested. ...
written 3.1 years ago by candida.vaz30
optimizing the -r/--mate-inner-dist in Tophat2
... Hello everyone, I have Illumina paired end (2*150bp) reads for 30 samples that I mapped to the reference genome using Tophat2. The sequencing providers gave me the following information: - The fragments used for sequencing range from 200 to 400bp - The average size is around 303 to 330bp. This inc ...
tophat2 rna-seq written 3.1 years ago by candida.vaz30
Comment: C: Using STAR aligner output for Htseq-count and Cufflinks
... Hello Devon, Thanks for your answer! I was wondering what is feature count? I am using Htseq-count. While running STAR **--outSAMtype BAM Unsorted SortedByCoordinate** we get two BAM files STAR manual recommends to use the output **Unsorted bam** file ...
written 3.7 years ago by candida.vaz30
6 follow
Using STAR aligner output for Htseq-count and Cufflinks
... Dear All, I am using STAR aligner for mapping my paired end reads using the following parameters: /cluster/apps/x86_64/packages/STAR_2.5/bin/STAR --runThreadN 4 --genomeDir /home/candidav/STAR-Gallus-gallus-nv5/Gallus-gallus-genome-dir-nv5 --readFilesIn /home/candidav/S1/RCI001-forward_paired.fas ...
rna-seq written 3.7 years ago by candida.vaz30 • updated 3.7 years ago by Devon Ryan98k
Trimmomatic : keepBothReads True vs False option
... Hello everyone, Is anyone familiar with the **"keepBothReads"** in **Trimmomatic** : **keepBothReads:** After read-through has been detected by palindrome mode, and the adapter sequence removed, the reverse read contains the same sequence information as the forward read, albeit in reverse complem ...
rna-seq written 3.7 years ago by candida.vaz30 • updated 3.7 years ago by Brian Bushnell17k
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... ...
written 3.7 years ago by candida.vaz30
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... Oh I see! But did you check your R1 and R2 files for the presence of the adapters mentioned by Illumina. My only issue is the sequence mentioned in the trimmomatic adapter file as 2 is actually for R1 and vice versa. ...
written 3.7 years ago by candida.vaz30
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... Hi Macspider, Could you please share the adapter file you used for removing adapters from Truseq PE data using Trimmomatic. Was your file similar to mine or did you use the "TruSeq3-PE-2.fa". Though the sequences and their reverse complements are the same, but if you notice, they are for opposite ...
written 3.7 years ago by candida.vaz30
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... So did you have the "TACACTCTTTCCCTACACGACGCTCTTCCGATCT" adapter seq in your R1 file and "GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT" seq in your R2 file? Could you check taking the top 200~ sequences of both your files ...
written 3.7 years ago by candida.vaz30
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... Yes it is also mentioned in the manual that one needs to mention the reverse complement. My doubt is regarding the universal usage of the Trimmomatic provided adapter file "TruSeq3-PE-2.fa". Should this file be used always? Or was I right in making my own file according to the adapters in my file. ...
written 3.7 years ago by candida.vaz30

Latest awards to candida.vaz

Great Question 3.0 years ago, created a question with more than 5,000 views. For Trimmomatic adapter file TruSeq3-PE-2.fa
Popular Question 3.0 years ago, created a question with more than 1,000 views. For Trimmomatic : keepBothReads True vs False option
Autobiographer 3.1 years ago, has more than 80 characters in the information field of the user's profile.
Popular Question 3.5 years ago, created a question with more than 1,000 views. For Trimmomatic adapter file TruSeq3-PE-2.fa


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1011 users visited in the last hour