User: candida.vaz

gravatar for candida.vaz
Reputation:
0
Status:
New User
Last seen:
6 hours ago
Joined:
1 year, 7 months ago
Email:
c**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by candida.vaz

<prev • 16 results • page 1 of 2 • next >
0
votes
0
answers
155
views
0
answers
Comment: C: optimizing the -r/--mate-inner-dist in Tophat2
... I have also used STAR aligner for mapping. Thanks for the information, will look up the publication you suggested. ...
written 7 weeks ago by candida.vaz0
0
votes
0
answers
155
views
0
answers
optimizing the -r/--mate-inner-dist in Tophat2
... Hello everyone, I have Illumina paired end (2*150bp) reads for 30 samples that I mapped to the reference genome using Tophat2. The sequencing providers gave me the following information: - The fragments used for sequencing range from 200 to 400bp - The average size is around 303 to 330bp. This inc ...
tophat2 rna-seq written 7 weeks ago by candida.vaz0
0
votes
1
answer
564
views
1
answers
Comment: C: Using STAR aligner output for Htseq-count and Cufflinks
... Hello Devon, Thanks for your answer! I was wondering what is feature count? I am using Htseq-count. http://www-huber.embl.de/HTSeq/doc/count.html While running STAR **--outSAMtype BAM Unsorted SortedByCoordinate** we get two BAM files STAR manual recommends to use the output **Unsorted bam** file ...
written 7 months ago by candida.vaz0
3
votes
1
answer
564
views
1
answer
Using STAR aligner output for Htseq-count and Cufflinks
... Dear All, I am using STAR aligner for mapping my paired end reads using the following parameters: /cluster/apps/x86_64/packages/STAR_2.5/bin/STAR --runThreadN 4 --genomeDir /home/candidav/STAR-Gallus-gallus-nv5/Gallus-gallus-genome-dir-nv5 --readFilesIn /home/candidav/S1/RCI001-forward_paired.fas ...
rna-seq written 7 months ago by candida.vaz0 • updated 7 months ago by Devon Ryan74k
2
votes
1
answer
337
views
1
answer
Trimmomatic : keepBothReads True vs False option
... Hello everyone, Is anyone familiar with the **"keepBothReads"** in **Trimmomatic** : **keepBothReads:** After read-through has been detected by palindrome mode, and the adapter sequence removed, the reverse read contains the same sequence information as the forward read, albeit in reverse complem ...
rna-seq written 8 months ago by candida.vaz0 • updated 8 months ago by Brian Bushnell15k
0
votes
1
answer
1.8k
views
1
answers
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... https://support.illumina.com/bulletins/2016/12/what-sequences-do-i-use-for-adapter-trimming.html ...
written 8 months ago by candida.vaz0
0
votes
1
answer
1.8k
views
1
answers
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... Oh I see! But did you check your R1 and R2 files for the presence of the adapters mentioned by Illumina. My only issue is the sequence mentioned in the trimmomatic adapter file as 2 is actually for R1 and vice versa. ...
written 8 months ago by candida.vaz0
0
votes
1
answer
1.8k
views
1
answers
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... Hi Macspider, Could you please share the adapter file you used for removing adapters from Truseq PE data using Trimmomatic. Was your file similar to mine or did you use the "TruSeq3-PE-2.fa". Though the sequences and their reverse complements are the same, but if you notice, they are for opposite ...
written 8 months ago by candida.vaz0
0
votes
1
answer
1.8k
views
1
answers
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... So did you have the "TACACTCTTTCCCTACACGACGCTCTTCCGATCT" adapter seq in your R1 file and "GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT" seq in your R2 file? Could you check taking the top 200~ sequences of both your files ...
written 8 months ago by candida.vaz0
0
votes
1
answer
1.8k
views
1
answers
Comment: C: Trimmomatic adapter file TruSeq3-PE-2.fa
... Yes it is also mentioned in the manual that one needs to mention the reverse complement. My doubt is regarding the universal usage of the Trimmomatic provided adapter file "TruSeq3-PE-2.fa". Should this file be used always? Or was I right in making my own file according to the adapters in my file. ...
written 8 months ago by candida.vaz0

Latest awards to candida.vaz

Autobiographer 7 weeks ago, has more than 80 characters in the information field of the user's profile.
Popular Question 6 months ago, created a question with more than 1,000 views. For Trimmomatic adapter file TruSeq3-PE-2.fa

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1734 users visited in the last hour