User: polag03

gravatar for polag03
polag030
Reputation:
0
Status:
New User
Last seen:
2 years, 3 months ago
Joined:
3 years ago
Email:
p******@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by polag03

<prev • 12 results • page 1 of 2 • next >
0
votes
0
answers
886
views
0
answers
Comment: C: Confusing edgeR result for reads without count
... Okay I see. Just one more thing... how is the LFC calculated for the three replicates? Is the average of the counts for each sample taken and used to compute the ratio (like average of rep1, rep2 and rep3 computed for each sample and used), or is there any other formula used? what is it? Thanks a l ...
written 2.3 years ago by polag030
0
votes
0
answers
886
views
0
answers
Comment: C: Confusing edgeR result for reads without count
... I have checked with the input data, the count matrix that was passed as input to edgeR is the same as represented in the output. The output counts are not pseudocounts. ...
written 2.3 years ago by polag030
0
votes
0
answers
886
views
0
answers
Comment: C: Confusing edgeR result for reads without count
... Ah, I missed that! I had gone through the manual before posting the question. let me just make some confirmations in my data. I will revert. Thanks a lot Macspider ...
written 2.3 years ago by polag030
0
votes
0
answers
886
views
0
answers
Comment: C: Confusing edgeR result for reads without count
... Thank you Macspider for the quick response. The null hypothesis is that the genes are not differentially expressed in the two samples. However, that is not why I am confused. The last 6 columns of the output are the raw counts of the genes in the two samples ( 3 replicates each). From the output, ...
written 2.3 years ago by polag030
2
votes
0
answers
886
views
0
answers
Confusing edgeR result for reads without count
... Hi all, Please I need clarification on this output from edgeR on differential expression analysis. Two samples with three replicates each are being compared. The output is confusing as these genes are reported by edgeR as being regulated (down) whereas the counts of the genes in the count matrix for ...
count matrix differential expression edger written 2.3 years ago by polag030
0
votes
1
answer
1.3k
views
1
answers
Comment: C: Create annotation file for mature miRNA sequences from mirBase
... yes it is This is more of the file cel-lin-4-3p 4 * 0 0 * * 0 0 ACACCTGGGCTCTCCGGGTACC IIIIIIIIIIIIIIIIIIIIII XM:i:0 cel-lin-4-5p 4 * 0 0 * * 0 0 TCCCTGAGACCTCAAGTGTGA IIIIIIIIIIIIIII ...
written 3.1 years ago by polag030 • updated 3.1 years ago by genomax70k
0
votes
1
answer
1.3k
views
1
answers
Comment: C: Create annotation file for mature miRNA sequences from mirBase
... Sure. Here is the output @HD VN:1.0 SO:unsorted @SQ SN:Chromosome01 LN:34959721 @SQ SN:Chromosome02 LN:32431396 @SQ SN:Chromosome03 LN:29412403 @SQ SN:Chromosome04 LN:28749345 @SQ SN:Chromosome05 LN:28438989 @SQ SN:Chromosome06 LN:27939960 ...
written 3.1 years ago by polag030 • updated 3.1 years ago by genomax70k
0
votes
1
answer
1.3k
views
1
answers
Comment: C: Create annotation file for mature miRNA sequences from mirBase
... Yes it is in the current directory. i also had to specify the path explicitly when i got the error, still got the error. ...
written 3.1 years ago by polag030
0
votes
1
answer
1.3k
views
1
answers
Comment: C: Create annotation file for mature miRNA sequences from mirBase
... I got that resolved, Prasad But I got the sam file of the alignment. When I tried to run the perl script to convert the sam file to gff i got a fatal error "Unable to open input file ". My command perl scampi_sam_to_gffv1.pl -i inputfile.sam -o outputfile.gff ...
written 3.1 years ago by polag030
0
votes
1
answer
1.3k
views
1
answers
Comment: C: Create annotation file for mature miRNA sequences from mirBase
... Hi Prasad, Thanks for the reply On a second look, the mirbase sequences are in fasta format while Bowtie takes fastq reads for alignment. is there a way around this? ...
written 3.1 years ago by polag030

Latest awards to polag03

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1422 users visited in the last hour