Admin: Pierre Lindenbaum

Reputation:
132,480
Status:
Trusted
Location:
France/Nantes/Institut du Thorax - INSERM UMR1087
Website:
http://plindenbaum.blo...
Twitter:
yokofakun
Scholar ID:
Google Scholar Page
Last seen:
10 minutes ago
Joined:
10 years, 10 months ago
Email:
p**********@yahoo.fr

Posts by Pierre Lindenbaum

<prev • 9,694 results • page 1 of 970 • next >
0
votes
0
answers
15
views
0
answers
Comment: C: merge vcf files from different tools
... what was your command ? what were those two variants ? ...
written 1 hour ago by Pierre Lindenbaum132k
1
vote
1
answer
28
views
1
answers
Comment: C: How to combine my fq file based on sample
... `zcat+gzip`. Don't . just use [cat][1]. [1]: https://www.biostars.org/p/81924/ ...
written 5 hours ago by Pierre Lindenbaum132k
0
votes
0
answers
60
views
0
answers
Comment: C: BWA index is not working
... I see no error here. what is the output of ls -la ref_genome ...
written 15 hours ago by Pierre Lindenbaum132k
1
vote
1
answer
58
views
1
answers
Comment: C: Subseq a FASTA file
... https://www.biostars.org/p/140118/ ...
written 16 hours ago by Pierre Lindenbaum132k
3
votes
1
answer
39
views
1
answers
Answer: C: VarScan output file genotypes
... [degenerate notation][1] ? [1]: https://en.wikipedia.org/wiki/Nucleic_acid_notation#IUPAC_notation ...
written 18 hours ago by Pierre Lindenbaum132k
0
votes
3
answers
4.0k
views
3
answers
Comment: C: How to get sample names and genotype for SNP in multi-sample VCF file
... > Could this allow such calls? no, it's not supported by the hsjdk library. https://github.com/samtools/htsjdk/blob/master/src/main/java/htsjdk/variant/variantcontext/Allele.java#L385 ...
written 18 hours ago by Pierre Lindenbaum132k
0
votes
0
answers
30
views
0
answers
Comment: C: Concatenate VCF files
... Hello zak ! Questions similar to yours can already be found at: Concatenate All Vcf.Gz Files How to combine chromosome vcf files VCF merge or concatenate? We have closed your question to allow us to keep similar content in the same thread. If you disagree with this please ...
written 1 day ago by Pierre Lindenbaum132k
1
vote
3
answers
44
views
3
answers
Answer: A: Read detection with pattern in paired end FASTQ file
... paste <(cat fq1 | paste - - - - ) <(cat fq2 | paste - - - - ) | grep TGTATGTAAACTTCCGACTTCAACTGTA | tr "\t" "\n" > interleaved.fastq ...
written 1 day ago by Pierre Lindenbaum132k
0
votes
2
answers
2.3k
views
2
answers
Comment: C: How to extract reads with no INDEL?
... ask as a new question please ...
written 1 day ago by Pierre Lindenbaum132k
0
votes
0
answers
36
views
0
answers
Comment: C: Running mauveAligner in Linux
... yes but that's `module`'s job to set the correct PATH... ...
written 1 day ago by Pierre Lindenbaum132k

Latest awards to Pierre Lindenbaum

Teacher 6 hours ago, created an answer with at least 3 up-votes. For A: picard sortsam error
Scholar 6 hours ago, created an answer that has been accepted. For A: picard sortsam error
Teacher 2 days ago, created an answer with at least 3 up-votes. For A: picard sortsam error
Scholar 2 days ago, created an answer that has been accepted. For A: picard sortsam error
Scholar 4 days ago, created an answer that has been accepted. For A: picard sortsam error
Teacher 7 days ago, created an answer with at least 3 up-votes. For A: picard sortsam error
Scholar 8 days ago, created an answer that has been accepted. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Scholar 8 days ago, created an answer that has been accepted. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Teacher 8 days ago, created an answer with at least 3 up-votes. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Scholar 9 days ago, created an answer that has been accepted. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Scholar 10 days ago, created an answer that has been accepted. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Teacher 10 days ago, created an answer with at least 3 up-votes. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Scholar 10 days ago, created an answer that has been accepted. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Teacher 11 days ago, created an answer with at least 3 up-votes. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Scholar 15 days ago, created an answer that has been accepted. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Scholar 18 days ago, created an answer that has been accepted. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Teacher 18 days ago, created an answer with at least 3 up-votes. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Scholar 4 weeks ago, created an answer that has been accepted. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Teacher 4 weeks ago, created an answer with at least 3 up-votes. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Scholar 4 weeks ago, created an answer that has been accepted. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Scholar 4 weeks ago, created an answer that has been accepted. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Popular Question 4 weeks ago, created a question with more than 1,000 views. For Ngs And Recalibration
Teacher 5 weeks ago, created an answer with at least 3 up-votes. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Scholar 5 weeks ago, created an answer that has been accepted. For A: How to get sample names and genotype for SNP in multi-sample VCF file
Teacher 5 weeks ago, created an answer with at least 3 up-votes. For A: Allele Depth (AD) / Allele Balance (AB) Filtering in GATK 4

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2017 users visited in the last hour