User: anshupa.vssut

gravatar for anshupa.vssut
Reputation:
20
Status:
New User
Location:
Last seen:
1 month, 3 weeks ago
Joined:
1 year, 9 months ago
Email:
a************@gmail.com

Posts by anshupa.vssut

<prev • 17 results • page 1 of 2 • next >
0
votes
0
answers
154
views
0
answers
Tools for polyA site identification in DNA sequences
... I am currently looking for tools which can help me to identify polyA sites in DNA sequence. Any suggestions for the same? I checked in omicstools.com regarding the same but most of the tool mentioned there were restricted to RNA sequence. ...
polya written 9 weeks ago by anshupa.vssut20 • updated 9 weeks ago by Andy0
0
votes
3
answers
348
views
3
answers
Comment: C: Identifying long stretches of Ns
... I am looking for regions were it is obvious to find gaps (N's) in hg19, I am not looking into hard masked repeat regions. ...
written 6 months ago by anshupa.vssut20
6
votes
3
answers
348
views
6 follow
3
answers
Identifying long stretches of Ns
... Is there a R package to identify long stretches of gaps (Ns) in human genome (hg19)? ...
genome R written 6 months ago by anshupa.vssut20 • updated 6 months ago by ATpoint3.8k
0
votes
0
answers
318
views
0
answers
Comment: C: Using SeqAn and other external libraries in C++
... Thanks a lot, the issue got resolved after adding -std=c++14 to g++ command. Thanks again. ...
written 7 months ago by anshupa.vssut20
0
votes
0
answers
318
views
0
answers
Using SeqAn and other external libraries in C++
... Hello All, I am new to C++ and also to using external libraries in C++. I am currently trying to use SeqAn for read mapping. I have created a Test.cpp with the following code: #include #include #include using namespace seqan; int main() { std::cout << CharStr ...
testing seqan tutorial seqan read mapping written 7 months ago by anshupa.vssut20
0
votes
0
answers
458
views
0
answers
Comment: C: Comparing position weight matrices
... I have already performed this analysis. I am currently looking for methods to handle short sequences of length upto 30 bp which are enriched for SNVs but are not identified by FIMO. For that, I represent these short sequences as position weight matrix(PWM) and intend to compare this with existing PW ...
written 10 months ago by anshupa.vssut20
1
vote
0
answers
458
views
0
answers
Comparing position weight matrices
... Hello All, I have my sequences represented as position weight matrix and wish to check for transcription factors occurring in those sequences. Can anyone suggest a tool that compares position weight matrices? ...
position weight matrix transcription factors written 10 months ago by anshupa.vssut20 • updated 10 months ago by WouterDeCoster28k
0
votes
0
answers
336
views
0
answers
Interpret fimo results in negative strand
... I have a simple question regarding interpreting fimo results in the negative strand. I got the following result in negative strand for transcription factor STAT3. HNF4A 295 315 STAT3_HUMAN.H10MO.A 12.7879 - 1.15e-05 0.118 ATGCAAGCTTGGCCAAGCCC Here Start position ...
fimo transcription factors motifs written 11 months ago by anshupa.vssut20 • updated 11 months ago by genomax47k
3
votes
2
answers
433
views
2
answers
Extract motif ids of all transcription factors in human
... Hello all, I wish to extract the motif ids of all transcription factors occurring in humans from JASPAR 2016. Is anyone aware of how to achieve this? ...
humans transcription factor jaspar written 11 months ago by anshupa.vssut20 • updated 6 months ago by asntech30
3
votes
0
answers
515
views
0
answers
Data retrieval icgc
... Is there a command line tool or r package to efficiently retrieve datasets from ICGC? ...
icgc r-package written 15 months ago by anshupa.vssut20

Latest awards to anshupa.vssut

Popular Question 3 months ago, created a question with more than 1,000 views. For Converting Vcf File To Maf

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1685 users visited in the last hour