User: anshupa.vssut

gravatar for anshupa.vssut
Reputation:
20
Status:
New User
Location:
Last seen:
3 weeks, 3 days ago
Joined:
1 year ago
Email:
a************@gmail.com

Posts by anshupa.vssut

<prev • 12 results • page 1 of 2 • next >
0
votes
0
answers
138
views
0
answers
Comment: C: Comparing position weight matrices
... I have already performed this analysis. I am currently looking for methods to handle short sequences of length upto 30 bp which are enriched for SNVs but are not identified by FIMO. For that, I represent these short sequences as position weight matrix(PWM) and intend to compare this with existing PW ...
written 7 weeks ago by anshupa.vssut20
1
vote
0
answers
138
views
0
answers
Comparing position weight matrices
... Hello All, I have my sequences represented as position weight matrix and wish to check for transcription factors occurring in those sequences. Can anyone suggest a tool that compares position weight matrices? ...
position weight matrix transcription factors written 7 weeks ago by anshupa.vssut20 • updated 7 weeks ago by WouterDeCoster20k
0
votes
0
answers
136
views
0
answers
Interpret fimo results in negative strand
... I have a simple question regarding interpreting fimo results in the negative strand. I got the following result in negative strand for transcription factor STAT3. HNF4A 295 315 STAT3_HUMAN.H10MO.A 12.7879 - 1.15e-05 0.118 ATGCAAGCTTGGCCAAGCCC Here Start position ...
fimo transcription factors motifs written 8 weeks ago by anshupa.vssut20 • updated 8 weeks ago by genomax32k
1
vote
1
answer
149
views
1
answer
Extract motif ids of all transcription factors in human
... Hello all, I wish to extract the motif ids of all transcription factors occurring in humans from JASPAR 2016. Is anyone aware of how to achieve this? ...
humans transcription factor jaspar written 9 weeks ago by anshupa.vssut20 • updated 9 weeks ago by WouterDeCoster20k
0
votes
0
answers
202
views
0
answers
Data retrieval icgc
... Is there a command line tool or r package to efficiently retrieve datasets from ICGC? ...
icgc r-package written 6 months ago by anshupa.vssut20
2
votes
1
answer
498
views
1
answer
Converting Vcf File To Maf
... I have a vcf file generated by in-house variant calling pipeline, containing both coding and non-coding SNVs can anyone suggest a tool or R-package for converting the vcf file to maf format? I needed to file in MAF format to visualize the mutation landscape using genvisr ...
vcf maf non-coding written 7 months ago by anshupa.vssut20 • updated 7 months ago by mbyvcm280
0
votes
0
answers
370
views
0
answers
Estimating background mutation rate
... Can anyone suggest a method to compute background mutation rate in non coding regions? ...
background mutation rate whole genome sequencing written 9 months ago by anshupa.vssut20 • updated 9 months ago by WouterDeCoster20k
0
votes
0
answers
245
views
0
answers
Music SMG test for non coding regions
... I am currently trying to run genome music for CTCF binding sites.How should my ROI file look like for the same? are there any specific modifications I need to do for running music for non coding regions? ...
maf music roi non-coding written 9 months ago by anshupa.vssut20 • updated 9 months ago by WouterDeCoster20k
0
votes
1
answer
370
views
1
answers
Comment: C: Genome Music for Enhancers and binding sites
... In that case what is the format for my ROI file?how should I supply the co-ordinates of non-coding regions? ...
written 9 months ago by anshupa.vssut20
1
vote
1
answer
370
views
1
answer
Genome Music for Enhancers and binding sites
... I am analyzing the relevance of DNA mutations at insulated neighborhood boundaries (i.e CTCF binding sites involved in chromatin looping). Can I use MUSiC for enhancers regions and CTCF binding sites ? ...
enhancer music binding sites written 11 months ago by anshupa.vssut20 • updated 11 months ago by Chris Miller18k

Latest awards to anshupa.vssut

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 759 users visited in the last hour