User: a.rex

gravatar for a.rex
a.rex240
Reputation:
240
Status:
Trusted
Location:
Last seen:
1 year, 5 months ago
Joined:
4 years, 2 months ago
Email:
a************@st-annes.ox.ac.uk

Posts by a.rex

<prev • 131 results • page 1 of 14 • next >
2
votes
0
answers
1.1k
views
0
answers
TPM normalization factors in RNA-seq
... I have perhaps a naive question: In RNA-seq with Kallisto, est_counts are generated and TPMs per transcripts can be calculated. However, to compare between sample, sleuth is used to calculate between sample normalization factors. Therefore, TPM for the individual libraries need to be normalized to ...
rna-seq written 17 months ago by a.rex240
1
vote
0
answers
452
views
0
answers
Estimate Library Complexity Output Histogram - what do duplicate sets mean exactly?
... I have run this command on my bam file (it has already gone through MARKDUP): java -jar picard.jar EstimateLibraryComplexity INPUT=lib.bam OUTPUT=sample_libcomp.txt I get this output: ## METRICS CLASS picard.sam.DuplicationMetrics LIBRARY UNPAIRED_READS_EXAMINED READ_PAIRS_EXAMIN ...
picard alignment written 19 months ago by a.rex240
5
votes
1
answer
304
views
1
answer
How to interpret a short TLEN with 75bp PE seq?
... I have a pair of mapped reads that look like this: > SRR8441376.12918543 99 g4_3 1773574 45 40S25M10S = 1773574 25 CAGCGTGAGCGGTTCGCTGAAGTCCGGCCCCAGTTCGCACATTTCGGTGACGAACTGCAACACCCGGTCTTGTTC AAAAAEEEAEEEEEEEEEE6EEEEEEEEEEEEEEEEEEEEAEEEEEEAE SRR8441376.12918543 147 g4_3 1773574 45 26S25M ...
sequence alignment written 19 months ago by a.rex240 • updated 19 months ago by Pierre Lindenbaum131k
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Insert size of -20bp with ATAC-seq?
... I did not filter chrM as we do not have this information. ...
written 19 months ago by a.rex240
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Insert size of -20bp with ATAC-seq?
... It is very odd - it is for a obscure species and published a few days ago. ...
written 19 months ago by a.rex240
3
votes
1
answer
329
views
1
answer
Understanding 9th field of Bam file - insert size?
... I have a pair of reads that look like this: SRR8441376.13963941 69 g4_1 558410 0 * = 558410 0 GTATAATCTAATTGTTCATGATGGAATTCATATTGTTCAATTGCGTTATTATAATTACTTAGTTGCTTAATTTG AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEE ...
alignment sequencing written 19 months ago by a.rex240 • updated 19 months ago by ATpoint40k
0
votes
1
answer
1.4k
views
1
answers
Comment: A: Insert size of -20bp with ATAC-seq?
... I realise now that perhaps a peak at 20bp (insert size) corresponds to a fragment of -95bp? ...
written 19 months ago by a.rex240
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Insert size of -20bp with ATAC-seq?
... I have uploaded said image now ...
written 19 months ago by a.rex240
4
votes
1
answer
1.4k
views
1
answer
Insert size of ~20bp with ATAC-seq?
... I have recently downloaded some publicly available ATAC-seq data. I aligned with BWA to reference genome, removed duplicate (in this instance 70% of library is duplicates), and then used picardtools to generate a fragment size distribution. However, I see a large peak at around 20bp? The library was ...
alignment atac-seq sequencing written 19 months ago by a.rex240 • updated 19 months ago by ATpoint40k
5
votes
1
answer
763
views
1
answer
How can I use featurecounts after generating a bam file using BWA?
... I have a reference transcriptome, to which I have aligned reads using BWA. My goal is to quantify the aligned transcripts - how can I do this? Can I use featurescounts - bearing in mind that I have aligned to a transcript fa file. ...
features counts rna-seq written 20 months ago by a.rex240 • updated 20 months ago by h.mon31k

Latest awards to a.rex

Popular Question 19 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 20 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 22 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 22 months ago, created a question with more than 1,000 views. For How do I go from UniProt ID to retrieving the gene name?
Popular Question 22 months ago, created a question with more than 1,000 views. For parsing through gtf file
Voter 23 months ago, voted more than 100 times.
Popular Question 24 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 24 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Centurion 2.0 years ago, created 100 posts.
Popular Question 2.0 years ago, created a question with more than 1,000 views. For Issues installing bcl2fastq?
Popular Question 2.1 years ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 2.2 years ago, created a question with more than 1,000 views. For parse error with samtools
Popular Question 2.2 years ago, created a question with more than 1,000 views. For Issues installing bcl2fastq?
Student 2.2 years ago, asked a question with at least 3 up-votes. For mapping reads to repetitive elements in genome?
Popular Question 2.3 years ago, created a question with more than 1,000 views. For Using LRT and Wald test to filter differentially expressed loci in RNA-seq dataset
Popular Question 2.4 years ago, created a question with more than 1,000 views. For createRepeatLandscape in RepeatMasker
Popular Question 2.8 years ago, created a question with more than 1,000 views. For Issues installing bcl2fastq?
Supporter 3.7 years ago, voted at least 25 times.
Student 3.8 years ago, asked a question with at least 3 up-votes. For mapping reads to repetitive elements in genome?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1469 users visited in the last hour