User: a.rex

gravatar for a.rex
a.rex180
Reputation:
180
Status:
Trusted
Location:
Last seen:
2 hours ago
Joined:
2 years, 7 months ago
Email:
a************@st-annes.ox.ac.uk

Posts by a.rex

<prev • 130 results • page 1 of 13 • next >
1
vote
0
answers
28
views
0
answers
Estimate Library Complexity Output Histogram - what do duplicate sets mean exactly?
... I have run this command on my bam file (it has already gone through MARKDUP): java -jar picard.jar EstimateLibraryComplexity INPUT=lib.bam OUTPUT=sample_libcomp.txt I get this output: ## METRICS CLASS picard.sam.DuplicationMetrics LIBRARY UNPAIRED_READS_EXAMINED READ_PAIRS_EXAMIN ...
picard alignment written 4 hours ago by a.rex180
5
votes
1
answer
72
views
1
answer
How to interpret a short TLEN with 75bp PE seq?
... I have a pair of mapped reads that look like this: > SRR8441376.12918543 99 g4_3 1773574 45 40S25M10S = 1773574 25 CAGCGTGAGCGGTTCGCTGAAGTCCGGCCCCAGTTCGCACATTTCGGTGACGAACTGCAACACCCGGTCTTGTTC AAAAAEEEAEEEEEEEEEE6EEEEEEEEEEEEEEEEEEEEAEEEEEEAE SRR8441376.12918543 147 g4_3 1773574 45 26S25M ...
sequence alignment written 6 days ago by a.rex180 • updated 6 days ago by Pierre Lindenbaum118k
0
votes
1
answer
148
views
1
answers
Comment: C: Insert size of -20bp with ATAC-seq?
... I did not filter chrM as we do not have this information. ...
written 6 days ago by a.rex180
0
votes
1
answer
148
views
1
answers
Comment: C: Insert size of -20bp with ATAC-seq?
... It is very odd - it is for a obscure species and published a few days ago. ...
written 6 days ago by a.rex180
3
votes
1
answer
79
views
1
answer
Understanding 9th field of Bam file - insert size?
... I have a pair of reads that look like this: SRR8441376.13963941 69 g4_1 558410 0 * = 558410 0 GTATAATCTAATTGTTCATGATGGAATTCATATTGTTCAATTGCGTTATTATAATTACTTAGTTGCTTAATTTG AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEE ...
alignment sequencing written 6 days ago by a.rex180 • updated 6 days ago by ATpoint14k
0
votes
1
answer
148
views
1
answers
Comment: A: Insert size of -20bp with ATAC-seq?
... I realise now that perhaps a peak at 20bp (insert size) corresponds to a fragment of -95bp? ...
written 6 days ago by a.rex180
0
votes
1
answer
148
views
1
answers
Comment: C: Insert size of -20bp with ATAC-seq?
... I have uploaded said image now ...
written 6 days ago by a.rex180
4
votes
1
answer
148
views
1
answer
Insert size of ~20bp with ATAC-seq?
... I have recently downloaded some publicly available ATAC-seq data. I aligned with BWA to reference genome, removed duplicate (in this instance 70% of library is duplicates), and then used picardtools to generate a fragment size distribution. However, I see a large peak at around 20bp? The library was ...
alignment atac-seq sequencing written 6 days ago by a.rex180 • updated 6 days ago by ATpoint14k
5
votes
1
answer
120
views
1
answer
How can I use featurecounts after generating a bam file using BWA?
... I have a reference transcriptome, to which I have aligned reads using BWA. My goal is to quantify the aligned transcripts - how can I do this? Can I use featurescounts - bearing in mind that I have aligned to a transcript fa file. ...
features counts rna-seq written 5 weeks ago by a.rex180 • updated 5 weeks ago by h.mon24k
1
vote
0
answers
154
views
0
answers
How can I get Kimura distances for individual loci from my align.fa file from RepeatMasker
... I have a set of transcripts which I have run through RepeatMasker. I have an output align file which I want to parse to get Kimura distances for individual loci? Does anyone have a script to do this? ...
repeatmasker written 3 months ago by a.rex180 • updated 11 weeks ago by Biostar ♦♦ 20

Latest awards to a.rex

Popular Question 5 days ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 5 weeks ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 10 weeks ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 10 weeks ago, created a question with more than 1,000 views. For How do I go from UniProt ID to retrieving the gene name?
Popular Question 10 weeks ago, created a question with more than 1,000 views. For parsing through gtf file
Voter 4 months ago, voted more than 100 times.
Popular Question 4 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 4 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Centurion 5 months ago, created 100 posts.
Popular Question 5 months ago, created a question with more than 1,000 views. For Issues installing bcl2fastq?
Popular Question 6 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 7 months ago, created a question with more than 1,000 views. For parse error with samtools
Popular Question 7 months ago, created a question with more than 1,000 views. For Issues installing bcl2fastq?
Student 7 months ago, asked a question with at least 3 up-votes. For mapping reads to repetitive elements in genome?
Popular Question 9 months ago, created a question with more than 1,000 views. For createRepeatLandscape in RepeatMasker
Popular Question 15 months ago, created a question with more than 1,000 views. For Issues installing bcl2fastq?
Supporter 2.1 years ago, voted at least 25 times.
Student 2.2 years ago, asked a question with at least 3 up-votes. For mapping reads to repetitive elements in genome?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 984 users visited in the last hour