User: a.rex

gravatar for a.rex
a.rex190
Reputation:
190
Status:
Trusted
Location:
Last seen:
2 months ago
Joined:
2 years, 11 months ago
Email:
a************@st-annes.ox.ac.uk

Posts by a.rex

<prev • 131 results • page 1 of 14 • next >
2
votes
0
answers
151
views
0
answers
TPM normalization factors in RNA-seq
... I have perhaps a naive question: In RNA-seq with Kallisto, est_counts are generated and TPMs per transcripts can be calculated. However, to compare between sample, sleuth is used to calculate between sample normalization factors. Therefore, TPM for the individual libraries need to be normalized to ...
rna-seq written 9 weeks ago by a.rex190
1
vote
0
answers
127
views
0
answers
Estimate Library Complexity Output Histogram - what do duplicate sets mean exactly?
... I have run this command on my bam file (it has already gone through MARKDUP): java -jar picard.jar EstimateLibraryComplexity INPUT=lib.bam OUTPUT=sample_libcomp.txt I get this output: ## METRICS CLASS picard.sam.DuplicationMetrics LIBRARY UNPAIRED_READS_EXAMINED READ_PAIRS_EXAMIN ...
picard alignment written 3 months ago by a.rex190
5
votes
1
answer
173
views
1
answer
How to interpret a short TLEN with 75bp PE seq?
... I have a pair of mapped reads that look like this: > SRR8441376.12918543 99 g4_3 1773574 45 40S25M10S = 1773574 25 CAGCGTGAGCGGTTCGCTGAAGTCCGGCCCCAGTTCGCACATTTCGGTGACGAACTGCAACACCCGGTCTTGTTC AAAAAEEEAEEEEEEEEEE6EEEEEEEEEEEEEEEEEEEEAEEEEEEAE SRR8441376.12918543 147 g4_3 1773574 45 26S25M ...
sequence alignment written 4 months ago by a.rex190 • updated 4 months ago by Pierre Lindenbaum121k
0
votes
1
answer
459
views
1
answers
Comment: C: Insert size of -20bp with ATAC-seq?
... I did not filter chrM as we do not have this information. ...
written 4 months ago by a.rex190
0
votes
1
answer
459
views
1
answers
Comment: C: Insert size of -20bp with ATAC-seq?
... It is very odd - it is for a obscure species and published a few days ago. ...
written 4 months ago by a.rex190
3
votes
1
answer
159
views
1
answer
Understanding 9th field of Bam file - insert size?
... I have a pair of reads that look like this: SRR8441376.13963941 69 g4_1 558410 0 * = 558410 0 GTATAATCTAATTGTTCATGATGGAATTCATATTGTTCAATTGCGTTATTATAATTACTTAGTTGCTTAATTTG AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEE ...
alignment sequencing written 4 months ago by a.rex190 • updated 4 months ago by ATpoint19k
0
votes
1
answer
459
views
1
answers
Comment: A: Insert size of -20bp with ATAC-seq?
... I realise now that perhaps a peak at 20bp (insert size) corresponds to a fragment of -95bp? ...
written 4 months ago by a.rex190
0
votes
1
answer
459
views
1
answers
Comment: C: Insert size of -20bp with ATAC-seq?
... I have uploaded said image now ...
written 4 months ago by a.rex190
4
votes
1
answer
459
views
1
answer
Insert size of ~20bp with ATAC-seq?
... I have recently downloaded some publicly available ATAC-seq data. I aligned with BWA to reference genome, removed duplicate (in this instance 70% of library is duplicates), and then used picardtools to generate a fragment size distribution. However, I see a large peak at around 20bp? The library was ...
alignment atac-seq sequencing written 4 months ago by a.rex190 • updated 4 months ago by ATpoint19k
5
votes
1
answer
210
views
1
answer
How can I use featurecounts after generating a bam file using BWA?
... I have a reference transcriptome, to which I have aligned reads using BWA. My goal is to quantify the aligned transcripts - how can I do this? Can I use featurescounts - bearing in mind that I have aligned to a transcript fa file. ...
features counts rna-seq written 5 months ago by a.rex190 • updated 5 months ago by h.mon26k

Latest awards to a.rex

Popular Question 4 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 5 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 6 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 6 months ago, created a question with more than 1,000 views. For How do I go from UniProt ID to retrieving the gene name?
Popular Question 6 months ago, created a question with more than 1,000 views. For parsing through gtf file
Voter 7 months ago, voted more than 100 times.
Popular Question 8 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 8 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Centurion 8 months ago, created 100 posts.
Popular Question 9 months ago, created a question with more than 1,000 views. For Issues installing bcl2fastq?
Popular Question 10 months ago, created a question with more than 1,000 views. For Fetching NCBI ID for a list of species?
Popular Question 11 months ago, created a question with more than 1,000 views. For parse error with samtools
Popular Question 11 months ago, created a question with more than 1,000 views. For Issues installing bcl2fastq?
Student 11 months ago, asked a question with at least 3 up-votes. For mapping reads to repetitive elements in genome?
Popular Question 11 months ago, created a question with more than 1,000 views. For Using LRT and Wald test to filter differentially expressed loci in RNA-seq dataset
Popular Question 13 months ago, created a question with more than 1,000 views. For createRepeatLandscape in RepeatMasker
Popular Question 18 months ago, created a question with more than 1,000 views. For Issues installing bcl2fastq?
Supporter 2.4 years ago, voted at least 25 times.
Student 2.5 years ago, asked a question with at least 3 up-votes. For mapping reads to repetitive elements in genome?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1905 users visited in the last hour