User: Carlos Caicedo

gravatar for Carlos Caicedo
Colombia/Universidad de Antioquia
Last seen:
1 month, 3 weeks ago
2 years, 9 months ago

Posts by Carlos Caicedo

<prev • 32 results • page 1 of 4 • next >
Comment: C: Transcriptome assembly evaluation with transrate
... I found the solution [here][1]. Some people solved this problem deleting the file Just in case, I renamed that one library and worked the problem out. [1]: ...
written 19 months ago by Carlos Caicedo130
Comment: C: Quantify number of a specific codon in a group of genes
... -For instance, this sequence has two TTA codon >EFG05278 cdna chromosome:Strep_clav_ATCC27064:chromosome:295573:297627:1 gene:SCLAV_0202 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:plcA description:Putative non-hemolytic phospholipase C ATGGCTGATGTCAACCGCCGC ...
written 20 months ago by Carlos Caicedo130 • updated 20 months ago by WouterDeCoster39k
Comment: C: Quantify number of a specific codon in a group of genes
... Because I do not have enough skills in programming to solve this problem, I tried searching some tools in omictools and some similar post here in Biostar, but I did not find any. TTA has to be inframe. ...
written 20 months ago by Carlos Caicedo130
Comment: C: Quantify number of a specific codon in a group of genes
... The fasta sequences are cdna ...
written 20 months ago by Carlos Caicedo130
Quantify number of a specific codon in a group of genes
... Dear all I have a fasta file with a specific genes of my interest and I want to know how many of them contain the codon TTA. Any idea to solve this little issue?. Thanks. ...
gene written 20 months ago by Carlos Caicedo130 • updated 20 months ago by WouterDeCoster39k
Answer: A: Drawing Venn Diagram
... Recently, I was exploring [Vennmaster][1] [1]: ...
written 21 months ago by Carlos Caicedo130
Comment: C: HMMER: Failed to open target sequence database for reading
... Hi cayro Did you prepare your database with `hmmpress`? `hmmpress` creates four binary files. The database cannot be read because it needs to have those four auxiliary binary files generated by hmmpress. ...
written 22 months ago by Carlos Caicedo130
Comment: C: How can I get Transcript ID from the gene ID?
... Of course, you are right. I going to try to do a better explanation of my question. A gff file is something like this: chromosome ena gene 661 1041 . - . ID=gene:SCLAV_0001;biotype=protein_coding;description=Hypothetical protein;gene_id=SCLAV_0001;logic_name=ena;version=1 chromosome ena tr ...
written 22 months ago by Carlos Caicedo130 • updated 22 months ago by genomax68k
Comment: C: How can I get Transcript ID from the gene ID?
... I have a data from a bacterium specie, so I think BioMart does not function in this case. ...
written 22 months ago by Carlos Caicedo130
How can I get Transcript ID from the gene ID?
... Dear all I have a list of gene IDs in a tabular format. How I can extract the transcript IDs for the list of genes IDs mentioned above, from a gff file? Thank you so much. Carlos ...
rna-seq written 22 months ago by Carlos Caicedo130 • updated 22 months ago by Jeffin Rockey1.1k

Latest awards to Carlos Caicedo

Popular Question 16 months ago, created a question with more than 1,000 views. For How can I get Transcript ID from the gene ID?
Teacher 2.4 years ago, created an answer with at least 3 up-votes. For A: transcriptome assembly evaluation


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1600 users visited in the last hour