User: Carlos Caicedo

gravatar for Carlos Caicedo
Colombia/Universidad de Antioquia
Last seen:
3 months ago
1 year, 8 months ago

Posts by Carlos Caicedo

<prev • 32 results • page 1 of 4 • next >
Comment: C: Transcriptome assembly evaluation with transrate
... I found the solution [here][1]. Some people solved this problem deleting the file Just in case, I renamed that one library and worked the problem out. [1]: ...
written 6 months ago by Carlos Caicedo120
Comment: C: Quantify number of a specific codon in a group of genes
... -For instance, this sequence has two TTA codon >EFG05278 cdna chromosome:Strep_clav_ATCC27064:chromosome:295573:297627:1 gene:SCLAV_0202 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:plcA description:Putative non-hemolytic phospholipase C ATGGCTGATGTCAACCGCCGC ...
written 6 months ago by Carlos Caicedo120 • updated 6 months ago by WouterDeCoster28k
Comment: C: Quantify number of a specific codon in a group of genes
... Because I do not have enough skills in programming to solve this problem, I tried searching some tools in omictools and some similar post here in Biostar, but I did not find any. TTA has to be inframe. ...
written 6 months ago by Carlos Caicedo120
Comment: C: Quantify number of a specific codon in a group of genes
... The fasta sequences are cdna ...
written 6 months ago by Carlos Caicedo120
Quantify number of a specific codon in a group of genes
... Dear all I have a fasta file with a specific genes of my interest and I want to know how many of them contain the codon TTA. Any idea to solve this little issue?. Thanks. ...
gene written 6 months ago by Carlos Caicedo120 • updated 6 months ago by WouterDeCoster28k
Answer: A: Drawing Venn Diagram
... Recently, I was exploring [Vennmaster][1] [1]: ...
written 8 months ago by Carlos Caicedo120
Comment: C: HMMER: Failed to open target sequence database for reading
... Hi cayro Did you prepare your database with `hmmpress`? `hmmpress` creates four binary files. The database cannot be read because it needs to have those four auxiliary binary files generated by hmmpress. ...
written 8 months ago by Carlos Caicedo120
Comment: C: How can I get Transcript ID from the gene ID?
... Of course, you are right. I going to try to do a better explanation of my question. A gff file is something like this: chromosome ena gene 661 1041 . - . ID=gene:SCLAV_0001;biotype=protein_coding;description=Hypothetical protein;gene_id=SCLAV_0001;logic_name=ena;version=1 chromosome ena tr ...
written 9 months ago by Carlos Caicedo120 • updated 9 months ago by genomax48k
Comment: C: How can I get Transcript ID from the gene ID?
... I have a data from a bacterium specie, so I think BioMart does not function in this case. ...
written 9 months ago by Carlos Caicedo120
How can I get Transcript ID from the gene ID?
... Dear all I have a list of gene IDs in a tabular format. How I can extract the transcript IDs for the list of genes IDs mentioned above, from a gff file? Thank you so much. Carlos ...
rna-seq written 9 months ago by Carlos Caicedo120 • updated 9 months ago by Jeffin Rockey480

Latest awards to Carlos Caicedo

Teacher 15 months ago, created an answer with at least 3 up-votes. For A: transcriptome assembly evaluation


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 689 users visited in the last hour