User: Love

gravatar for Love
Love100
Reputation:
100
Status:
New User
Location:
Last seen:
7 years, 11 months ago
Joined:
7 years, 12 months ago
Email:
z*******@gmail.com

Posts by Love

<prev • 29 results • page 1 of 3 • next >
0
votes
1
answer
5.9k
views
1
answers
Comment: C: A Result From Mummer Alignment
... Yes, it is a good idea. How can I find your email from the profile? ...
written 7.9 years ago by Love100
0
votes
1
answer
5.9k
views
1
answers
Comment: C: A Result From Mummer Alignment
... I uploaded files [here](https://skydrive.live.com/?cid=03a8bb9eaeeff1db#cid=03A8BB9EAEEFF1DB&id=3A8BB9EAEEFF1DB%21234). Could you please help me to look at them? ...
written 8.0 years ago by Love100 • updated 6 weeks ago by RamRS24k
0
votes
1
answer
5.9k
views
1
answers
Comment: C: A Result From Mummer Alignment
... I upload files here. Could you help me to look at them? ...
written 8.0 years ago by Love100
0
votes
1
answer
5.9k
views
1
answers
Comment: C: A Result From Mummer Alignment
... The file exists but is empty(0kb). Do seq1.fa and seq2.fa need same length? ...
written 8.0 years ago by Love100
0
votes
1
answer
5.9k
views
1
answers
Comment: C: A Result From Mummer Alignment
... I used the command nucmer -p out seq1.fa seq2.fa to align the two sequences, but why the align file is empty? ...
written 8.0 years ago by Love100
0
votes
1
answer
5.9k
views
1
answers
Comment: C: A Result From Mummer Alignment
... I might spoke it incorrectly. Do you mean I need to create a delta file first? My question is that because nucmer uses mummer for its maximal exact matching, can I also find non-match?Is it an align file? How to generate it? ...
written 8.0 years ago by Love100
0
votes
1
answer
5.9k
views
1
answers
Comment: C: A Result From Mummer Alignment
... I might spoke it correctly. Do you mean I need to create a delta file first? My question is that because nucmer uses mummer for its maximal exact matching, can I also find non-match?Is it an align file? How to generate it? ...
written 8.0 years ago by Love100
0
votes
1
answer
5.9k
views
1
answers
Comment: C: A Result From Mummer Alignment
... Yes, I found delta-filter. What is meant by the header. such as: tagA1 tagB1 500 20000000 ...
written 8.0 years ago by Love100
0
votes
1
answer
5.9k
views
1
answers
Comment: C: A Result From Mummer Alignment
... What I want to find at least say at least 80% identical match in reference and query. I need their positions in both sequence and letters. For example, AGCTG 51 55 AGTTG 78 82 They have 4 same letters in 5. 4/5=80% ...
written 8.0 years ago by Love100
10
votes
1
answer
5.9k
views
1
answer
A Result From Mummer Alignment
... Hello, I run the mummer command for a pairwaise alignment mummer -s -mum refer.txt query.txt > refer_query.align The result is: > query 1450 9370 21 gaggttgcagtgagctgagat 2122 9771 21 caaaaaaaaaaaaaaaaaaaa 3296 9570 26 gaggtcaggagatcgagaccatcctg ...
alignment written 8.0 years ago by Love100 • updated 8.0 years ago by Vitis2.3k

Latest awards to Love

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1118 users visited in the last hour