User: nkinney06

gravatar for nkinney06
nkinney0630
Reputation:
30
Status:
New User
Location:
Last seen:
2 weeks, 4 days ago
Joined:
3 years, 9 months ago
Email:
n********@gmail.com

Posts by nkinney06

<prev • 25 results • page 1 of 3 • next >
0
votes
0
answers
2.5k
views
0
answers
Comment: C: simple polygenic risk example
... My understanding is that usually you will have a list of SNP genotypes with each having an odds ratio determined by comparing a control group and experimental group of samples (usually 1000s of samples). You take the log of all the odds ratios and sum the logs; so, for an unknown sample check each S ...
written 18 days ago by nkinney0630
0
votes
0
answers
185
views
0
answers
co-translational or post-translational protein targeting
... I have a list of serum proteins. Like most - if not all - secreted proteins they have cleavable N-terminal signal peptide sequences. I want to know (or predict) if the signal peptide is cleaved co-translationally or post-translationally. Is there a tool looking this up? I have tried searching litera ...
gene written 9 months ago by nkinney0630
0
votes
0
answers
414
views
0
answers
Tool: CAGm: a repository of germline microsatellite variations in the 1000 genomes project
... **CAGm: a repository of germline microsatellite variations in the 1000 genomes project** We present the Comparative Analysis of Germline Microsatellites (CAGm): a database of germline microsatellites from 2529 individuals in the 1000 genomes project. A key novelty of CAGm is the ability to aggregat ...
microsatellites tool 1000 genomes project written 21 months ago by nkinney0630
0
votes
0
answers
298
views
0
answers
(Closed) chaperone protein names
... I am studying chaperon proteins DnaK, DnaJ etc. This question sounds trivial but I would like to know what the acronym stands for. I have looked on google/google scholar. My best guess is that the name comes from the fact that these are genes whose products are necessary for bacteriophage DNA replic ...
gene names written 23 months ago by nkinney0630
0
votes
1
answer
571
views
1
answers
Comment: C: what's sequences are in the precomputed human_genomic database
... this is better than the README file but when I use blast is says Effective search space used: 1344767968614 Database: NCBI genome chromosomes - human Posted date: Jul 19, 2017 11:08 PM Number of letters in database: 64,036,671,579 Number of sequences in database: 3, ...
written 2.1 years ago by nkinney0630
2
votes
1
answer
571
views
1
answer
what's sequences are in the precomputed human_genomic database
... I recently installed blast and downloaded the precomputed human_genomic.*tar.gz database available here: ftp://ftp.ncbi.nlm.nih.gov/blast/db/ I tested my installation with the following fasta file: cat test_query.fa >chr13:83987454-83987503 GCTGGGTGGTCAGCGCTGGTTCCATGGGCAGTAATGATTT ...
blast written 2.1 years ago by nkinney0630 • updated 2.1 years ago by genomax87k
0
votes
2
answers
773
views
2
answers
Answer: A: cruzDB coordinates vs UCSC coordinates
... I'm surprised this question has received little attention as I am quite convinced there is an inconsistency in the cruzdb coordinate system; running the following code should be convincing enough. import cruzdb from cruzdb import Genome g = cruzdb.Genome('hg38') ########## ...
written 2.6 years ago by nkinney0630
0
votes
2
answers
773
views
2
answers
Comment: C: cruzDB coordinates vs UCSC coordinates
... Update: for anyone that uses cruzdb you may want to look into this unsolved issue. I received this comment from the developer: probably, these comparisons: https://github.com/brentp/cruzdb/blob/master/cruzdb/models.py#L81 need to use >= instead of >. If you verify that, I'll make ...
written 2.6 years ago by nkinney0630
1
vote
2
answers
773
views
2
answers
cruzDB coordinates vs UCSC coordinates
... I am confused by a subtle difference in the cruzdb coordinates and UCSC coordinates. For those unfamiliar cruzdb is a python package for accessing the UCSC databases. Suppose I am interested in exon 3/7 for the gene TAF3. This exon extends from base pair 7963920-7965742 on chromosome 10. You can be ...
python genome coordinates cruzdb ucsc written 2.6 years ago by nkinney0630 • updated 2.5 years ago by max40
0
votes
2
answers
719
views
2
answers
Comment: C: how to get cruzbd (cds_sequence) dna translation
... thank you! I have done both; but, I have a followup question. If we take another look at the region I used as an example: chromosome = "chr19" start = 55014736 stop = 55014753 and compare to the entry in the refGene.txt file from UCSC we see that this region is between the transcriptio ...
written 2.6 years ago by nkinney0630

Latest awards to nkinney06

Popular Question 8 months ago, created a question with more than 1,000 views. For where to download GRCh36
Popular Question 8 months ago, created a question with more than 1,000 views. For why does this pipe work
Popular Question 21 months ago, created a question with more than 1,000 views. For where to download GRCh36
Popular Question 21 months ago, created a question with more than 1,000 views. For simple polygenic risk example
Popular Question 2.4 years ago, created a question with more than 1,000 views. For simple polygenic risk example

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1043 users visited in the last hour