User: nkinney06

gravatar for nkinney06
New User
Last seen:
3 weeks, 2 days ago
1 year, 8 months ago

Posts by nkinney06

<prev • 21 results • page 1 of 3 • next >
Comment: C: what's sequences are in the precomputed human_genomic database
... this is better than the README file but when I use blast is says Effective search space used: 1344767968614 Database: NCBI genome chromosomes - human Posted date: Jul 19, 2017 11:08 PM Number of letters in database: 64,036,671,579 Number of sequences in database: 3, ...
written 24 days ago by nkinney0630
what's sequences are in the precomputed human_genomic database
... I recently installed blast and downloaded the precomputed human_genomic.*tar.gz database available here: I tested my installation with the following fasta file: cat test_query.fa >chr13:83987454-83987503 GCTGGGTGGTCAGCGCTGGTTCCATGGGCAGTAATGATTT ...
blast written 24 days ago by nkinney0630 • updated 24 days ago by genomax51k
Answer: A: cruzDB coordinates vs UCSC coordinates
... I'm surprised this question has received little attention as I am quite convinced there is an inconsistency in the cruzdb coordinate system; running the following code should be convincing enough. import cruzdb from cruzdb import Genome g = cruzdb.Genome('hg38') ########## ...
written 6 months ago by nkinney0630
Comment: C: cruzDB coordinates vs UCSC coordinates
... Update: for anyone that uses cruzdb you may want to look into this unsolved issue. I received this comment from the developer: probably, these comparisons: need to use >= instead of >. If you verify that, I'll make ...
written 6 months ago by nkinney0630
cruzDB coordinates vs UCSC coordinates
... I am confused by a subtle difference in the cruzdb coordinates and UCSC coordinates. For those unfamiliar cruzdb is a python package for accessing the UCSC databases. Suppose I am interested in exon 3/7 for the gene TAF3. This exon extends from base pair 7963920-7965742 on chromosome 10. You can be ...
python genome coordinates cruzdb ucsc written 6 months ago by nkinney0630 • updated 5 months ago by max10
Comment: C: how to get cruzbd (cds_sequence) dna translation
... thank you! I have done both; but, I have a followup question. If we take another look at the region I used as an example: chromosome = "chr19" start = 55014736 stop = 55014753 and compare to the entry in the refGene.txt file from UCSC we see that this region is between the transcriptio ...
written 6 months ago by nkinney0630
how to get cruzbd (cds_sequence) dna translation
... I have a genomic region of interest and I am trying to retrieve the gene (if its in one) and amino acid sequence (if its in a translated region). Suppose my region of interest is: chromosome = "chr19" start = 55014736 stop = 55014753 If I put this into USCS genome browser by hand I see it's in gen ...
python cruzdb written 7 months ago by nkinney0630 • updated 6 months ago by genecats.ucsc500
brain scan databases
... I am wondering if there are any standard "brain scan" databases with data from fMRI, dMRI, sMRI, PET, CT scans etc for human. Im interested in addiction primarily, possible diabetes, heart disease, COPD, and anything that plausibly affects the brain. Ideally would be able to look up scans for these ...
imaging databases written 10 months ago by nkinney0630 • updated 10 months ago by Jean-Karim Heriche16k
Comment: C: Use machine learning as classifier
... look up the pybrain tutorial on neural networks for classification ...
written 12 months ago by nkinney0630
simple polygenic risk example
... I am trying to calculate polygenic risk scores. Basically these are calculated using a set of weighted SNPs. The score assigned to an individual can be correlated with many things such as risk for disease. Many polygenic risk scores (or models) have been devised and published in literature. I though ...
polygenic risk snp written 12 months ago by nkinney0630 • updated 12 months ago by Biostar ♦♦ 20

Latest awards to nkinney06

Popular Question 4 months ago, created a question with more than 1,000 views. For simple polygenic risk example


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1009 users visited in the last hour