User: rdlady

gravatar for rdlady
rdlady0
Reputation:
0
Status:
New User
Last seen:
6 months, 2 weeks ago
Joined:
8 months, 3 weeks ago
Email:
r*****@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by rdlady

<prev • 12 results • page 1 of 2 • next >
0
votes
0
answers
215
views
0
answers
Is there a database with information on percent spliced in (PSI) fraction for a gene?
... I have a quick question. Is there any databases with information on the percent spliced in (PSI) fraction of a given gene? I was wondering is this kind of experimental data is stored in any database. It would be great if I could use an Ensenbl gene ID as input, for example, and get the PSI score ...
gene genome splicing transcription written 6 months ago by rdlady0
1
vote
2
answers
346
views
2
answers
Answer: A: retrieve complete gene sequence (exons and introns) from SNP name (rsid)
... I think I got it!!!!! R's biomaRt library is amazing! I was able to retrieve the complete gene sequences (introns+exons) for the gene where my SNP is located. I made an R script that retrieves the complete gene sequence and its variations using a SNP name or rsid as input. The script is available ...
written 6 months ago by rdlady0
0
votes
2
answers
346
views
2
answers
Comment: C: retrieve complete gene sequence (exons and introns) from SNP name (rsid)
... Oh I see it. Thanks! But I still couldn't find a way to automatically download the complete ORF using these queries. ...
written 6 months ago by rdlady0
0
votes
2
answers
346
views
2
answers
Comment: C: retrieve complete gene sequence (exons and introns) from SNP name (rsid)
... I mean the unspliced gene sequences (intros+exons). I found the biomaRt R package that seems to do what I want, but I'm learning about it yet. I will share the info here if biomaRt is able to extract the complete ORF/gene. ...
written 6 months ago by rdlady0
0
votes
2
answers
346
views
2
answers
Comment: C: retrieve complete gene sequence (exons and introns) from SNP name (rsid)
... Thanks for your reply! Sorry maybe I didn't expained myself well in my example: I want the COMPLETE GENE sequence, including introns and exons, not the Xbp flanking sequence. And I want an automatic method, not a website that I have to click, because I will have to retrieve this info for more than 1 ...
written 6 months ago by rdlady0
0
votes
2
answers
346
views
2
answers
Comment: C: retrieve complete gene sequence (exons and introns) from SNP name (rsid)
... Thanks for answering, but in the dbSNP I can't find the complete gene sequence (introns and exons included) of the gene belonging to the SNPs. Where exactly do you click to find that? ...
written 6 months ago by rdlady0
2
votes
2
answers
346
views
2
answers
retrieve complete gene sequence (exons and introns) from SNP name (rsid)
... I have a list of SNPs that consists of their rsids or SNP names, like rs6699871, for example. From that list, I would like to retrieve a list of gene variations that result from that SNP. I would expect something like this as output: rs6699871 var1 CTACATCGATTTGCAGCACCCAGCTGA[C]CCAGAAATCGACAAGTCGAC ...
gene genome sequence snp sequencing written 6 months ago by rdlady0
0
votes
3
answers
491
views
3
answers
Answer: A: Importing SNP and phenotype data from dbGaP into R
... I ended up never being able to use those XML files as source of Phenotype data, but I was able to find phenotype data files in a very simple tabular text format when I requested the download of my dbGaP dataset again. So for some reason, only the XML files where available when I made the first downl ...
written 6 months ago by rdlady0
0
votes
3
answers
491
views
3
answers
Comment: C: Importing SNP and phenotype data from dbGaP into R
... You probably should request an account to access all the content of dbGaP database, because some datasets are not open to the public. In my case I had to request an account because I needed to have access these closed datasets. ...
written 6 months ago by rdlady0
0
votes
3
answers
491
views
3
answers
Answer: A: Importing SNP and phenotype data from dbGaP into R
... I have decrypted the dbGaP files but now the problem is that I can't map the phenotype files to genotype files, so I have a bunch of information on SNPs but I don't know to who they belong (cases or controls, male or female, age, etc). Does anyone know how to map the genotypes to phenotypes in the ...
written 8 months ago by rdlady0

Latest awards to rdlady

Scholar 6 months ago, created an answer that has been accepted. For A: retrieve complete gene sequence (exons and introns) from SNP name (rsid)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 725 users visited in the last hour