User: mollysil

gravatar for mollysil
New User
Last seen:
9 months ago
2 years, 1 month ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by mollysil

<prev • 24 results • page 1 of 3 • next >
Comment: C: Add taxonomic info to FASTA headers from csv file
... Thank you for such a detailed response. I assume there is a way to do this with a simple perl or python script? Or do you think I could use the join command maybe (can this be used with a FASTA and CSV file, as opposed to a TXT file)? I can't get access to Biopython on the server I'm using to run ...
written 10 months ago by mollysil0
Comment: C: Add taxonomic info to FASTA headers from csv file
... Any Perl solutions perhaps? ...
written 10 months ago by mollysil0
Add taxonomic info to FASTA headers from csv file
... I want to change my FASTA headers (in file named VT.fasta) to reflect taxonomic information. Right now they have accession information only, like this: >gb|AJ854100_VTX00001 >AGCAGCCGCGGTAATTCCAGCTCCAATAGCGTAGGCGAGCGACTGCCG >gb|AF202299_VTX00002 >GTAACGGGGAATTAGGGTTCCAATCCCGACACGGGG ...
fasta headers sequence taxonomic information written 10 months ago by mollysil0 • updated 10 months ago by Bastien Hervé2.8k
Comment: C: Use R for Mantel Test for Correlation of Diversity v. Soil Properties
... Thank you!! I figured it would be something obvious like that. ...
written 12 months ago by mollysil0
Use R for Mantel Test for Correlation of Diversity v. Soil Properties
... I am using R Studio (vegan package) to run mantel tests to see if the microbial species diversity in my samples was correlated with specific soil properties (such as, nitrogen or soil pH). (This is hopefully a very simplistic answer for someone more familiar with the R vegan package than myself). ...
diversity R mantel test soil written 12 months ago by mollysil0 • updated 4 months ago by samisheen140
Comment: C: Change OTU names to taxon names
... I modified my question to better explain the table I wish to make. Let me know if you have any ideas for this. You code didn't make the table I envisioned because I didn't explain my question correctly. ...
written 14 months ago by mollysil0
Comment: C: Change OTU names to taxon names
... Is the example better explained now? ...
written 14 months ago by mollysil0
Comment: C: Change OTU names to taxon names
... Thanks. I edited my post. ...
written 14 months ago by mollysil0
Change OTU names to taxon names
... I have two .csv tables: Table 1 depicts the abundance of each OTU of interest (columns) found at each sampling site (rows). The column headers are the arbitrary OTU names (ex: OTU_1) and rows are labeled by site (ex: AF141 stands for American Farm sampled in 2014, replicate #1) ...
otu taxon written 14 months ago by mollysil0
Comment: C: How to retrieve rows from OTU table
... Magical! Thanks so much!!! ...
written 14 months ago by mollysil0

Latest awards to mollysil

Popular Question 13 months ago, created a question with more than 1,000 views. For How To Rename FASTA Headers


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1627 users visited in the last hour