User: mollysil

gravatar for mollysil
mollysil0
Reputation:
0
Status:
New User
Last seen:
3 months ago
Joined:
1 year, 7 months ago
Email:
m*******@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by mollysil

<prev • 24 results • page 1 of 3 • next >
0
votes
1
answer
204
views
1
answers
Comment: C: Add taxonomic info to FASTA headers from csv file
... Thank you for such a detailed response. I assume there is a way to do this with a simple perl or python script? Or do you think I could use the join command maybe (can this be used with a FASTA and CSV file, as opposed to a TXT file)? I can't get access to Biopython on the server I'm using to run ...
written 4 months ago by mollysil0
0
votes
1
answer
204
views
1
answers
Comment: C: Add taxonomic info to FASTA headers from csv file
... Any Perl solutions perhaps? ...
written 4 months ago by mollysil0
1
vote
1
answer
204
views
1
answer
Add taxonomic info to FASTA headers from csv file
... I want to change my FASTA headers (in file named VT.fasta) to reflect taxonomic information. Right now they have accession information only, like this: >gb|AJ854100_VTX00001 >AGCAGCCGCGGTAATTCCAGCTCCAATAGCGTAGGCGAGCGACTGCCG >gb|AF202299_VTX00002 >GTAACGGGGAATTAGGGTTCCAATCCCGACACGGGG ...
fasta headers sequence taxonomic information written 4 months ago by mollysil0 • updated 4 months ago by Bastien Hervé1.5k
0
votes
0
answers
549
views
0
answers
Comment: C: Use R for Mantel Test for Correlation of Diversity v. Soil Properties
... Thank you!! I figured it would be something obvious like that. ...
written 6 months ago by mollysil0
1
vote
0
answers
549
views
0
answers
Use R for Mantel Test for Correlation of Diversity v. Soil Properties
... I am using R Studio (vegan package) to run mantel tests to see if the microbial species diversity in my samples was correlated with specific soil properties (such as, nitrogen or soil pH). (This is hopefully a very simplistic answer for someone more familiar with the R vegan package than myself). ...
diversity R mantel test soil written 6 months ago by mollysil0 • updated 6 months ago by genomax52k
0
votes
1
answer
329
views
1
answers
Comment: C: Change OTU names to taxon names
... I modified my question to better explain the table I wish to make. Let me know if you have any ideas for this. You code didn't make the table I envisioned because I didn't explain my question correctly. ...
written 8 months ago by mollysil0
0
votes
1
answer
329
views
1
answers
Comment: C: Change OTU names to taxon names
... Is the example better explained now? ...
written 8 months ago by mollysil0
0
votes
1
answer
329
views
1
answers
Comment: C: Change OTU names to taxon names
... Thanks. I edited my post. ...
written 8 months ago by mollysil0
0
votes
1
answer
329
views
1
answer
Change OTU names to taxon names
... I have two .csv tables: Table 1 depicts the abundance of each OTU of interest (columns) found at each sampling site (rows). The column headers are the arbitrary OTU names (ex: OTU_1) and rows are labeled by site (ex: AF141 stands for American Farm sampled in 2014, replicate #1) ...
otu taxon written 8 months ago by mollysil0
0
votes
2
answers
405
views
2
answers
Comment: C: How to retrieve rows from OTU table
... Magical! Thanks so much!!! ...
written 8 months ago by mollysil0

Latest awards to mollysil

Popular Question 7 months ago, created a question with more than 1,000 views. For How To Rename FASTA Headers

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 699 users visited in the last hour