User: RT

gravatar for RT
RT350
Reputation:
350
Status:
Trusted
Location:
European Union
Last seen:
an hour ago
Joined:
8 years, 10 months ago
Email:
t***********@gmail.com

Posts by RT

<prev • 144 results • page 1 of 15 • next >
0
votes
0
answers
229
views
0
answers
adapter trimming using trimmomatic
... Hi All, I ran fastqc on my chipseq dataset and a redflag is raised for overrepresented sequences. 29% of this sequence- GATCGGAAGAGCACACGTCTGAACTCCAGTCACACA (possible source- Trueseq adapter) I ran trimmomatic for both Trueseq2 and Trueseq3 but both don't seem to trim anything. Any suggestions? ...
adapter trimming next-gen sequencing written 7 months ago by RT350
0
votes
0
answers
174
views
0
answers
ChIPQC cross-coverage plot
... Hi All, I'm analyzing some chipseq data and getting a little odd cross-coverage plot. For info- I'm using Chipqc package to create cross -coverage plot and the dataset is from E.coli. I'm wondering why this doesn't have a small peak at readlength (36bp)? image link- https://ibb.co/j6hhjCc Another q ...
chip-seq cross-coverage chipqc written 7 months ago by RT350
0
votes
0
answers
250
views
0
answers
Comment: C: expression evidence for overlapping genes
... correct me if I am asking a dumb question. How does stranded RNA-seq solves my problem. Overlapping gene can exist in different frame, not necessarily from different strand. ...
written 17 months ago by RT350
0
votes
0
answers
250
views
0
answers
expression evidence for overlapping genes
... Hi All, Can anyone point out to me method/tool to get the expression evidence for overlapping genes. Thanks, Rit ...
rna-seq written 17 months ago by RT350
0
votes
0
answers
753
views
0
answers
Comment: C: 2x - University Research Fellows - Bioinformatics, University of Adelaide, Adela
... Hi David, The link given isn't working. Are these positions filled? Thanks, RT ...
written 2.3 years ago by RT350
0
votes
0
answers
871
views
0
answers
Comment: C: calculating dn/ds from codeml output
... Hi Biojl, thanks for the response. No, I have used a software from a collaborator and now I have to do he dn/ds calculations by hand as part of paper resubmission response. What I understand is fetching W2 values from ModelA where the likelihood score is maximum for different omega starting values ( ...
written 2.5 years ago by RT350
0
votes
0
answers
871
views
0
answers
calculating dn/ds from codeml output
... Hi everyone, I ran branch-site models and made the comparisons of likelihood values modelA vs modelA null and modelA vs m1a. The omega values used are 0,1,2 and 10. I now need to extract dn/ds of my gene. Can someone help me how to extract this from codeml output. Thanks, RT ...
codeml written 2.5 years ago by RT350
0
votes
0
answers
5.1k
views
0
answers
Comment: A: Open positions at the Center for Molecular Oncology, MSKCC, New York
... Hi Cyriac, Since this post is modified two days ago, I am wondering if these positions are still open? ...
written 2.5 years ago by RT350
0
votes
1
answer
972
views
1
answer
Data mining for 300 genes from GEO
... Hi All, I have a gene list of ~ 300 genes. I want to get from GEO all the high-throughput expression studies for these genes. I can write a R script to make this search with GEOsearch package. But I guess the package only allows for geneid/name based search. I was wondering if there is a way to sea ...
geo written 3.5 years ago by RT350 • updated 2.7 years ago by Biostar ♦♦ 20
0
votes
1
answer
3.5k
views
1
answers
Comment: C: Select top differentially expressed genes based on both p-value and fold-change
... so what is the best way to select top genes? As I said, I was suggested to consider both p-values and fold-change and use rankproduct for this. Rankproduct is used for identification of DEGs. I am not sure how to apply it to foldchange and pvalue. Any other ideas of combining pval and fc for seelc ...
written 3.6 years ago by RT350

Latest awards to RT

Popular Question 7 weeks ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 7 months ago, created a question with more than 1,000 views. For translate position in cds to position in nucleotide sequence
Popular Question 7 months ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 16 months ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 16 months ago, created a question with more than 1,000 views. For Mapping coordinates from gff file to individual gene
Popular Question 16 months ago, created a question with more than 1,000 views. For loss of function prediction
Great Question 16 months ago, created a question with more than 5,000 views. For How to extract all the mapped reads from bwa output
Scholar 16 months ago, created an answer that has been accepted. For A: snpeff Warnings , transcript incomplete
Popular Question 16 months ago, created a question with more than 1,000 views. For plotting FPKM in R
Popular Question 20 months ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 20 months ago, created a question with more than 1,000 views. For Gene id to gene name mapping
Popular Question 21 months ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 21 months ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 2.1 years ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 2.2 years ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Great Question 2.2 years ago, created a question with more than 5,000 views. For How to extract all the mapped reads from bwa output
Popular Question 2.2 years ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 2.2 years ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 2.3 years ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 2.4 years ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Popular Question 2.9 years ago, created a question with more than 1,000 views. For Running Codeml On Unrooted Tree
Great Question 2.9 years ago, created a question with more than 5,000 views. For How To Correctly Classify Gene Families?
Great Question 2.9 years ago, created a question with more than 5,000 views. For How to extract all the mapped reads from bwa output

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1438 users visited in the last hour