User: fishgolden

gravatar for fishgolden
fishgolden360
Reputation:
360
Status:
Trusted
Location:
Last seen:
7 hours ago
Joined:
2 years ago
Email:
k***************@gmail.com

-_-

Posts by fishgolden

<prev • 85 results • page 1 of 9 • next >
0
votes
1
answer
113
views
1
answers
Comment: C: Install trimmomatic on windows computer?
... I could run trimmomatic with windows 10 Home + openjdk version "1.8.0_192" OpenJDK Runtime Environment (build 1.8.0_192-amazon-corretto-preview2-b12) OpenJDK 64-Bit Server VM (build 25.192-b12, mixed mode) ...
written 8 hours ago by fishgolden360
0
votes
1
answer
105
views
1
answers
Answer: A: PSSM format for command-line PSIBLAST
... I think you have an ascii pssm file. I think psi-blast accepts only asn.1 format file as pssm which is non-human-friendly format. The asn.1 format files can be downloaded from cdd FTP site ftp://ftp.ncbi.nih.gov/pub/mmdb/cdd/ as cdd.tar.gz . BUUUUUT using that pssm, I got an error as follows (I t ...
written 16 days ago by fishgolden360
1
vote
1
answer
189
views
1
answers
Comment: C: Help with dynamic programming algorithm
... I see. Now I understand. That is >Because global alignment is the method which is designed to find optimal alignment utilizing all regions of both sequences. With that procedure, the gap length in 5' region becomes shorter & the alignment tends to utilize all regions. Please imagine two se ...
written 28 days ago by fishgolden360
1
vote
1
answer
189
views
1
answers
Comment: C: Help with dynamic programming algorithm
... >instead in the semi-global I start from the greater value in the last row or last column, right? Yes, that's right. >You know the reason why? I couldn't find the strange part. You mean "why they set the constant value (-2) for penalty"? One of the reasons may be it's very easy to implemen ...
written 29 days ago by fishgolden360
2
votes
1
answer
189
views
1
answers
Answer: A: Help with dynamic programming algorithm
... >Why to reconstruct alignment is used traceback? Is not right to start from the fist cell of directions matrix? Furthermore, is compulsory to start from bottom-right cell? Why? "the fist cell of directions matrix" means top left cell? Because if you start from top left, you cannot know which dir ...
written 29 days ago by fishgolden360
0
votes
4
answers
1.4k
views
4
answers
Comment: C: Misunderstood parameter of NCBI BLAST
... According to the [Reply to the paper: Misunderstood parameters of NCBI BLAST impacts the correctness of bioinformatics workflows][1], + there was a bug. [1]: https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/bty1026/5259186 ...
written 7 weeks ago by fishgolden360
0
votes
2
answers
939
views
2
answers
Comment: C: (solved) I couldn't reproduce the problem of max_target_seqs
... Thank you for the notification! I was very surprized that there was a bug. It made problems complicated........ ...
written 7 weeks ago by fishgolden360
2
votes
3
answers
269
views
3
answers
Answer: A: Perl#replace a sequence name in fasta file with another name
... I think the Error is in structures of input fasta file. Your script seems not work fine unless your fasta file is as follows, i guess. >seq1 something=something=something=something=XP_020088267.1 ATGGCTGATGCTGAGGATATTCAGCCACTCGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCTGGTGATGA >seq ...
written 12 weeks ago by fishgolden360
0
votes
1
answer
136
views
1
answers
Comment: C: Why is there a difference in results when using HHpred server and HHsearch stand
... The difference in "Searched_HMMs" means that the searches are performed against different (versions of) databases, i think. BTW, hhpred uses hhblits to construct input a3m before the final search. Did you surely turn it off with the "Parameters" tab? ...
written 12 weeks ago by fishgolden360
0
votes
1
answer
311
views
1
answers
Comment: C: Missing hhm_db and a3m_db for HHSuite
... Please share (copy & paste) command you used and error messages you got. Please do not use "find". ...
written 12 weeks ago by fishgolden360

Latest awards to fishgolden

Supporter 26 days ago, voted at least 25 times.
Scholar 29 days ago, created an answer that has been accepted. For A: Reason of excluding homolog protein in protein subcellular location prediction
Scholar 11 weeks ago, created an answer that has been accepted. For A: Reason of excluding homolog protein in protein subcellular location prediction
Student 3 months ago, asked a question with at least 3 up-votes. For (solved) I couldn't reproduce the problem of max_target_seqs
Autobiographer 16 months ago, has more than 80 characters in the information field of the user's profile.
Scholar 21 months ago, created an answer that has been accepted. For A: Reason of excluding homolog protein in protein subcellular location prediction

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1395 users visited in the last hour