User: fishgolden

gravatar for fishgolden
fishgolden280
Reputation:
280
Status:
Trusted
Location:
Last seen:
11 hours ago
Joined:
1 year, 10 months ago
Email:
k***************@gmail.com

-_-

Posts by fishgolden

<prev • 78 results • page 1 of 8 • next >
2
votes
3
answers
207
views
3
answers
Answer: A: Perl#replace a sequence name in fasta file with another name
... I think the Error is in structures of input fasta file. Your script seems not work fine unless your fasta file is as follows, i guess. >seq1 something=something=something=something=XP_020088267.1 ATGGCTGATGCTGAGGATATTCAGCCACTCGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCTGGTGATGA >seq ...
written 23 days ago by fishgolden280
0
votes
0
answers
68
views
0
answers
Comment: C: Why is there a difference in results when using HHpred server and HHsearch stand
... The difference in "Searched_HMMs" means that the searches are performed against different (versions of) databases, i think. BTW, hhpred uses hhblits to construct input a3m before the final search. Did you surely turn it off with the "Parameters" tab? ...
written 25 days ago by fishgolden280
0
votes
1
answer
234
views
1
answers
Comment: C: Missing hhm_db and a3m_db for HHSuite
... Please share (copy & paste) command you used and error messages you got. Please do not use "find". ...
written 26 days ago by fishgolden280
0
votes
1
answer
234
views
1
answers
Comment: C: Missing hhm_db and a3m_db for HHSuite
... Sorry, I can remember that I tried both; compile from source code & apt-get, and I'm not sure which one is working now. By the way, according to your screen shot, the path to the database is different from that of you showed in the original post > /home/b/Downloads/pdb70/pdb70 is now > ...
written 29 days ago by fishgolden280
0
votes
1
answer
234
views
1
answers
Comment: C: Missing hhm_db and a3m_db for HHSuite
... I see. thank you. I haven't used v2.x these days. ...
written 4 weeks ago by fishgolden280
0
votes
1
answer
234
views
1
answers
Comment: C: Missing hhm_db and a3m_db for HHSuite
... Which version are you using? With my v 3.0.3, hhsearch doesn't need suffix like _hhm.ffdata thus I think > hhsearch -cpu 6 -i /home/example.faa -d /home/b/Downloads/pdb70/pdb70 -B 10 -Z 10 -E 1E-03 will work (didn't checked cuz i don't have enough disk space to download pdb70 sorry). PS. I c ...
written 4 weeks ago by fishgolden280
0
votes
2
answers
776
views
2
answers
Comment: C: (solved) I couldn't reproduce the problem of max_target_seqs
... Thank you for the information! & Thank you for taking the trouble to ask the support. I have checked google chache and archive.is but couldn't confirm the date. ...
written 5 weeks ago by fishgolden280
0
votes
2
answers
776
views
2
answers
Comment: C: (solved) I couldn't reproduce the problem of max_target_seqs
... I agree with you " I don't think BLAST guarantees an optimal solution every time. If you need to ensure that then Smith-Waterman should be used instead.". Heuristically, I cannot decide which group of sequences is wanted - A group of sequences which have high scores in preliminary step but lower ...
written 6 weeks ago by fishgolden280
2
votes
2
answers
776
views
2
answers
Comment: C: (solved) I couldn't reproduce the problem of max_target_seqs
... Thank you! https://www.ncbi.nlm.nih.gov/books/NBK279684/#_appendices_Outline_of_the_BLAST_process_ is a good explanation. It matches with what I could understand from the source codes of BLAST. The matter I was referring is written in C4 as N_i. And what lieven.sterck referred is written in C3 as ...
written 6 weeks ago by fishgolden280
1
vote
2
answers
253
views
2
answers
Answer: A: protein profile from alignment
... HHmake will make hmm profile & hhsearch will compare query profile to db of profiles. https://github.com/soedinglab/hh-suite ...
written 7 weeks ago by fishgolden280

Latest awards to fishgolden

Scholar 21 days ago, created an answer that has been accepted. For A: Reason of excluding homolog protein in protein subcellular location prediction
Student 6 weeks ago, asked a question with at least 3 up-votes. For (solved) I couldn't reproduce the problem of max_target_seqs
Autobiographer 14 months ago, has more than 80 characters in the information field of the user's profile.
Scholar 19 months ago, created an answer that has been accepted. For A: Reason of excluding homolog protein in protein subcellular location prediction

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1051 users visited in the last hour