User: Ric

gravatar for Ric
Ric240
Reputation:
240
Status:
Trusted
Location:
Australia
Last seen:
3 days, 3 hours ago
Joined:
7 years, 5 months ago
Email:
m*******@gmail.com

Posts by Ric

<prev • 184 results • page 1 of 19 • next >
0
votes
0
answers
45
views
0
answers
Trinotate sqlite and gene_to_trans_map
... Hi, I would like to run `autoTrinotate.pl` but how do I generate files for parameters `--Trinotate_sqlite` and `--gene_to_trans_map`? Thank you in advance, ...
rna-seq written 3 days ago by Ric240
2
votes
0
answers
59
views
0
answers
BRAKER miss some genes despite of RNA-Seq evidence
... Hi, I ran `braker.pl --UTR=on --genome=$1 --bam=$2 --species=$3 --cores 20 --softmasking --gff3` but in few cases, BRAKER did not predict any genes where there is RNA-Seq alignment. Is there a way to get still gene predictions for those missing areas? Thank you in advance, ...
genome assembly rna-seq braker written 3 days ago by Ric240 • updated 3 days ago by ATpoint19k
0
votes
0
answers
57
views
0
answers
Comment: C: BioNano fasta file formatting issue
... Thank you for the tool. It found AGAGATATTGTCATATGAAATGAGTCAGAAAGACCTCTAGTTATAGGTGGTAGAGGTTGTATGTCTGTTGCTTAATAGGCAATCAATCATGCCGATTTTATGCCAAGATAATCGATTATTCACTTTACATAATCGATTATCTTCTAAACGTTCataaaaacggaacg) Aborting .. found 1 error Unfortunately, it does not tell what it is and how to fix it? ...
written 8 days ago by Ric240
0
votes
0
answers
57
views
0
answers
BioNano fasta file formatting issue
... Hi, We have received a FASTA from BioNano. I ran **reformat.sh -Xmx=8080m in=HYBRID_SCAFFOLD.fa out=HYBRID_SCAFFOLD-reformat.fa** but got the bellow error ... ATATGAAATGAGTCAGAAAGACCTCTAGTTATAGGTGGTAGAGGTTGTATGTCTGTTGCTTAATAGGCAATCAATCATGCCGATTTTATGCCAAGATAATCGATTATTCACTTTACATAATCGAT ...
genome assembly sequence written 8 days ago by Ric240
0
votes
0
answers
123
views
0
answers
Visualizing Orthologs and Paralogs genes
... Hi I ran [PorthoMCL](https://github.com/etabari/PorthoMCL/) and I would like to visualise the results may be as a circos plot. PorthoMCL contains two output files: - [Orthologs](https://github.com/etabari/PorthoMCL/blob/master/sample/8.all.ort.group) sample output file and - [Paralogs](https://gi ...
orthologs visualizing circos gene paralogs written 8 weeks ago by Ric240
0
votes
1
answer
298
views
1
answers
Comment: C: Retraining Augustus with BUSCO
... Thank you. Do you know how to add UTR training? ...
written 11 weeks ago by Ric240
3
votes
0
answers
220
views
0
answers
Retraining Augustus for UTR
... Hi, I used to retrain Augustus with help of BUSCO in the following way: 1. run_BUSCO.py -i NbV1Ch07.fasta -o augustus_busco -l /assembly/busco-embryophyta_odb9/ -m geno --cpu 1 --long -sp coyote_tobacco --augustus_parameters='--progress=true' 2. copied the files from `/augustus/run_augustus_busco/a ...
gene annotation written 11 weeks ago by Ric240 • updated 10 weeks ago by Biostar ♦♦ 20
0
votes
1
answer
298
views
1
answers
Comment: C: Retraining Augustus with BUSCO
... Thank you. I ran BUSCO with `-sp coyote_tobacco` option. Should I have removed it and should I used a hard masked repeat assembly file for retraining Augustus? ...
written 11 weeks ago by Ric240
2
votes
1
answer
298
views
1
answer
Retraining Augustus with BUSCO
... Hi, I tried to follow this [instruction][1] on how to retrain Augustus with BUSCO. I ran BUSCO: run_BUSCO.py -i NbV1Ch07.fasta -o augustus_busco -l /assembly/busco-embryophyta_odb9/ -m geno --cpu 1 --long -sp coyote_tobacco --augustus_parameters='--progress=true' and it created a folder `/augu ...
gene assembly annotation written 11 weeks ago by Ric240
0
votes
2
answers
265
views
2
answers
Comment: C: splitting a SAM file
... I used your command but the files are still empty. The dryrun function created e.g. this command `samtools view -o Backbone_1.bam output.gfa1.onlymapped.sorted.sam Backbone_1 && samtools index Backbone_1.bam && samtools fasta Backbone_1.bam > Backbone_1.fasta`. What did I miss? ...
written 11 weeks ago by Ric240

Latest awards to Ric

Popular Question 5 weeks ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Supporter 10 weeks ago, voted at least 25 times.
Popular Question 12 weeks ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 3 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 3 months ago, created a question with more than 1,000 views. For How to calculate the insert size for Paired-end reads
Popular Question 3 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Great Question 5 months ago, created a question with more than 5,000 views. For Fastqc And Require Tools
Popular Question 5 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 5 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 6 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 7 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 7 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 8 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 8 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 10 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 12 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 12 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 15 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 16 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Popular Question 16 months ago, created a question with more than 1,000 views. For estimate genome coverage
Popular Question 20 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools
Centurion 21 months ago, created 100 posts.
Great Question 21 months ago, created a question with more than 5,000 views. For Fastqc And Require Tools
Scholar 22 months ago, created an answer that has been accepted. For A: topGo Error in .local(.Object, ...) : allGenes must be a factor with 2 levels
Popular Question 23 months ago, created a question with more than 1,000 views. For Fastqc And Require Tools

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 970 users visited in the last hour