User: dimitrischat

gravatar for dimitrischat
dimitrischat110
Reputation:
110
Status:
Trusted
Location:
Last seen:
1 day, 12 hours ago
Joined:
3 years, 3 months ago
Email:
d***********@gmail.com

Posts by dimitrischat

<prev • 125 results • page 1 of 13 • next >
0
votes
0
answers
45
views
0
answers
How to Blast with multiple species - Phylogenetic Analysis
... Hi all. Need some advice on how to proceed with phylogenetics analysis. I got a fasta file with amino acid sequences from human. (There are about 270 sequences - this number isnt important - just mentioning it) >chr1:228672725-228672991 tcgatctcttgatcttgtgatccacctgcctcagcctcccaaagtgctgg ...
alignment sequence chip-seq written 3 days ago by dimitrischat110
0
votes
0
answers
58
views
0
answers
Comment: C: Help for OmicsBox - Blast2GO
... it seems like i had to rename the output with the extension .xml, then it worked.. As i recall i didnt have to do that with the previous version. Anyhow, thank you!! Cheers ...
written 5 days ago by dimitrischat110
0
votes
0
answers
58
views
0
answers
Help for OmicsBox - Blast2GO
... Hello, I ran blastx and blastp locally with outfmt 16 (13-16 is ok with omicsbox). But when i try to run for both blastx blastp an error occurs at mapping stage: "There are no sequences with BLAST results to perform GO Mapping" Do i need to put some extra options when i run blastx or blastp ? I ...
rna-seq written 8 days ago by dimitrischat110
0
votes
0
answers
110
views
0
answers
Comment: C: Phylogenetics analysis between diverse species
... Hello. Any input? Thanks ...
written 26 days ago by dimitrischat110
0
votes
0
answers
72
views
0
answers
Comment: A: How to edit large txt file and how to find commons
... can someone please delete this post also. i deleted in stack, i cant delete it here ...
written 5 weeks ago by dimitrischat110
0
votes
0
answers
72
views
0
answers
Comment: C: How to edit large txt file and how to find commons
... So, if someone is in stackexchange it automatically means he is also in biostars? ( i deleted my post in stackexchange so you can relax) ...
written 5 weeks ago by dimitrischat110
0
votes
0
answers
72
views
0
answers
Comment: C: How to edit large txt file and how to find commons
... and thats prohibited? ...
written 5 weeks ago by dimitrischat110
0
votes
0
answers
72
views
0
answers
After KEGG and GO analysis, how to make tables+phylogenetic trees
... Hello all, hope everyone is ok. I used Trinity to do a de novo transcriptome assembly, then blastp/blastx and then used Blast2GO software to do KEGG and GO analysis. So i got some txt files with header : for GO > Sequence name Sequence desc. Sequence length Hit desc. Hit > ACC E-Value Simil ...
assembly rna-seq written 5 weeks ago by dimitrischat110
0
votes
0
answers
110
views
0
answers
Comment: C: Phylogenetics analysis between diverse species
... Yes its all human. He didnt clarify, but i am guessing species that represent different taxonomies (or some significant sub category). ...
written 5 weeks ago by dimitrischat110
0
votes
0
answers
110
views
0
answers
Comment: C: Phylogenetics analysis between diverse species
... Thanks for the answer. Yes its an assignment. How should i proceed ? ...
written 5 weeks ago by dimitrischat110

Latest awards to dimitrischat

Popular Question 3 months ago, created a question with more than 1,000 views. For from txt to bed
Centurion 3 months ago, created 100 posts.
Popular Question 6 months ago, created a question with more than 1,000 views. For from txt to bed
Popular Question 6 months ago, created a question with more than 1,000 views. For STAR fusion error
Popular Question 7 months ago, created a question with more than 1,000 views. For from txt to bed
Popular Question 10 months ago, created a question with more than 1,000 views. For from txt to bed
Popular Question 15 months ago, created a question with more than 1,000 views. For from txt to bed
Popular Question 16 months ago, created a question with more than 1,000 views. For from txt to bed
Popular Question 18 months ago, created a question with more than 1,000 views. For Editing Bed file
Popular Question 23 months ago, created a question with more than 1,000 views. For from txt to bed
Popular Question 23 months ago, created a question with more than 1,000 views. For Editing Bed file
Supporter 2.6 years ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 915 users visited in the last hour