User: snishtala03

gravatar for snishtala03
snishtala0330
Reputation:
30
Status:
New User
Location:
Last seen:
1 day, 1 hour ago
Joined:
2 years, 9 months ago
Email:
s**********@gmail.com

Posts by snishtala03

<prev • 25 results • page 1 of 3 • next >
0
votes
0
answers
70
views
0
answers
Comment: C: single contig de novo assembly
... Ah, interesting! My host is human. I will try to remove human reads and then try this again. ...
written 25 days ago by snishtala0330
1
vote
0
answers
70
views
0
answers
single contig de novo assembly
... Hello, I am working with RNA-Seq data for a virus. My collaborator gave me a predicted single contig reference which belongs to a particular genotype (let's say GenotypeA) of the virus. Now, some of my samples are from a different genotype (B,C or D) and therefore their mapping % when aligned to my ...
de-novo assembly contig rna-seq written 25 days ago by snishtala0330
0
votes
0
answers
175
views
0
answers
Comment: C: Splicing in virus using long read sequencing
... Since these are PacBio reads the read lengths are variable and MISO cannot handle variable read lengths currently. Can you suggest any other tool or method to do this? ...
written 8 weeks ago by snishtala0330
0
votes
0
answers
175
views
0
answers
Comment: C: Splicing in virus using long read sequencing
... So my Reference genome is about 3000bp long. It is a predicted reference generated by our team, so we know of a few potential transcripts and exons and their start and end sites but no genes or their locations. MISO needs a gff file. I created a gff with these transcripts and putative splice sites a ...
written 4 months ago by snishtala0330
0
votes
0
answers
175
views
0
answers
Comment: C: Splicing in virus using long read sequencing
... I did but what I am looking for is those plots showing exons and other alternative splicing events and also number of reads supporting it. ...
written 4 months ago by snishtala0330
0
votes
0
answers
175
views
0
answers
Splicing in virus using long read sequencing
... Hello, I am working on a project where long read sequencing was done using PacBio for a virus genome. I aligned the reads using minimap2, a splice aware aligner and can see splices when I view the bam files on IGV. Now, I am trying to explore these results further by trying to generate figures sh ...
minimap2 splicing long read sequencing pacbio written 4 months ago by snishtala0330
0
votes
0
answers
221
views
0
answers
primers for PacBio lima software
... Hello, I am new to processing PacBio data so please excuse me for a naive question. I have 6 samples and 3 of them used Clontech 3' CDS Primer II A: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)N-1N–3’ and the other 3 used - project specific design: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)GWAGC -3’ When running li ...
isoseq clontech lima primer pacbio written 5 months ago by snishtala0330
0
votes
0
answers
283
views
0
answers
Comment: C: count reads mapped to multiple locations only once
... Thanks for your response! So while I was trying to this, I came across this example below. It shows that a read has secondary alignments and supplementary alignments, but not all of them are seen in the bam file. Is this how secondary and supplementary alignments usually appear or does this mean t ...
written 7 months ago by snishtala0330
1
vote
0
answers
283
views
0
answers
count reads mapped to multiple locations only once
... Hello, I have paired end data which I am mapping (using bwa - mem) to 17 viral references which are ~85% similar to one another (i.e I have one reference file that I give to bwa mem which has 17 different fastqs). So, obviously, I have most of my reads mapping to multiple references. Which is neede ...
multiple mapping alignment samtools bwa written 7 months ago by snishtala0330
1
vote
1
answer
1.2k
views
1
answers
Answer: A: samtools stats result different from samtools flagstat
... I think I figured it out - It looks like 60970 reads in flagstat includes the supplementary reads while stats does not count it. 52505 + 8465 = 60970 ...
written 8 months ago by snishtala0330

Latest awards to snishtala03

Popular Question 25 days ago, created a question with more than 1,000 views. For GAGE or GSEABase using expression data and pathway.gmt file for mouse
Popular Question 2.2 years ago, created a question with more than 1,000 views. For GAGE or GSEABase using expression data and pathway.gmt file for mouse

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 956 users visited in the last hour