User: snishtala03

gravatar for snishtala03
snishtala0310
Reputation:
10
Status:
New User
Location:
Last seen:
an hour ago
Joined:
2 years, 4 months ago
Email:
s**********@gmail.com

Posts by snishtala03

<prev • 19 results • page 1 of 2 • next >
0
votes
0
answers
105
views
0
answers
primers for PacBio lima software
... Hello, I am new to processing PacBio data so please excuse me for a naive question. I have 6 samples and 3 of them used Clontech 3' CDS Primer II A: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)N-1N–3’ and the other 3 used - project specific design: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)GWAGC -3’ When running li ...
isoseq clontech lima primer pacbio written 5 weeks ago by snishtala0310
0
votes
0
answers
179
views
0
answers
Comment: C: count reads mapped to multiple locations only once
... Thanks for your response! So while I was trying to this, I came across this example below. It shows that a read has secondary alignments and supplementary alignments, but not all of them are seen in the bam file. Is this how secondary and supplementary alignments usually appear or does this mean t ...
written 3 months ago by snishtala0310
0
votes
0
answers
179
views
0
answers
count reads mapped to multiple locations only once
... Hello, I have paired end data which I am mapping (using bwa - mem) to 17 viral references which are ~85% similar to one another (i.e I have one reference file that I give to bwa mem which has 17 different fastqs). So, obviously, I have most of my reads mapping to multiple references. Which is neede ...
multiple mapping alignment samtools bwa written 3 months ago by snishtala0310
0
votes
1
answer
373
views
1
answers
Answer: A: samtools stats result different from samtools flagstat
... I think I figured it out - It looks like 60970 reads in flagstat includes the supplementary reads while stats does not count it. 52505 + 8465 = 60970 ...
written 3 months ago by snishtala0310
1
vote
1
answer
373
views
1
answer
samtools stats result different from samtools flagstat
... I am using samtools v1.6 to get some stats on my bam file. Here, I merged my two paired end reads and ran bwa twice, once on merged reads and once on unmerged reads and then merged the two .bam files using samtools merge. I then used both samtools stats and samtools flagstat to get some stats but in ...
samtools written 3 months ago by snishtala0310
0
votes
1
answer
203
views
1
answers
Comment: C: bbmerge merged read smaller that original reads
... Thank you for your response. I was using an older version, I updated my version to the current one - 38.44 and I get correctly merged reads! I used vsearch for that example, I think they do account for errors, not sure though. ...
written 3 months ago by snishtala0310
1
vote
1
answer
203
views
1
answer
bbmerge merged read smaller that original reads
... Hello, I have some paired end (2x150 bps) RNA-Seq reads from MiSeq for a viral genome. I need to merge the reads for a downstream analysis.(Also, since I noticed that when I merge my reads, there are a lot of reads which have a high overlap rate, merging them makes sense) - bbmerge.sh in1=R1. ...
bbmerge fastq alignment flash vsearch written 3 months ago by snishtala0310 • updated 3 months ago by RamRS23k
0
votes
1
answer
10k
views
1
answers
Comment: C: Introducing Clumpify: Create 30% Smaller, Faster Gzipped Fastq Files. And remov
... I tried it that way too. I used clumpify on original data but still found a lot of duplicates. This is RNA-Seq data from a virus. The length of the genome is ~3000 bps. I need the duplicates remove because I am look at heterogeneity at a particular location and I need deduplicated reads for it. ...
written 3 months ago by snishtala0310
0
votes
1
answer
10k
views
1
answers
Comment: C: Introducing Clumpify: Create 30% Smaller, Faster Gzipped Fastq Files. And remov
... I have paired end sequencing data from MiSeq. For an analysis, I am required to merge the reads. So, I merged the reads using bbmerge.sh and then use clumpify. I have the same start and the length of the reads is also the same. Reads In: 2925342 Clumps Formed: 5527 ...
written 3 months ago by snishtala0310
0
votes
1
answer
10k
views
1
answers
Comment: C: Introducing Clumpify: Create 30% Smaller, Faster Gzipped Fastq Files. And remov
... These should be PCR duplicates. After aligning them to my reference, I see the same read mapping to the same chromosome , having the same start site multiple times. ...
written 3 months ago by snishtala0310

Latest awards to snishtala03

Popular Question 21 months ago, created a question with more than 1,000 views. For GAGE or GSEABase using expression data and pathway.gmt file for mouse

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1038 users visited in the last hour