User: alirezamomeni707

Reputation:
0
Status:
New User
Last seen:
3 days, 10 hours ago
Joined:
1 month, 1 week ago
Email:
a***************@yahoo.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by alirezamomeni707

<prev • 12 results • page 1 of 2 • next >
0
votes
0
answers
85
views
5 follow
0
answers
DE analysis of single cell RNAseq
... I have scRNAseq data (counts files not fastq files). I got 3 types of counts including: 1- BarcodeCounts 2- ReadCounts 3- TranscriptCounts now I want to do differentially expression analysis to identify DE genes. for normal RNAseq we ususally use read counts to identify significant ge ...
rna-seq written 4 days ago by alirezamomeni7070 • updated 4 days ago by kennethcondon2007530
0
votes
1
answer
73
views
1
answers
Answer: C: how to get the coverage for the entire interval
... bedtools genomecov -ibam accepted_hits.bam -g GRCh37.p13.genome.fa > output.txt I want read counts per position. ...
written 20 days ago by alirezamomeni7070
1
vote
1
answer
73
views
1
answer
how to get the coverage for the entire interval
... I have aligned my `RNA-seq` data and trying to get the coverage of 72 `nt` sequence using `bedtools`. I also have the coordinate of this sequence. when I get the coverage results, that is only for 62 bases. I want to get the coverage for the entire interval not `5p` or `3p`. do you know how to solve ...
alignment rna-seq written 20 days ago by alirezamomeni7070
0
votes
0
answers
112
views
0
answers
Comment: C: counting the reads mapped to specific coordinate in the genome
... if you mean to use for instance HTseq_count, I have tried to use it but it needs GTF file which has information for all genes. if you get it from gencode or other websites, the information for the tRNA variants are not included. if I get the specific GTF file from the website relate to the the gene ...
written 22 days ago by alirezamomeni7070
0
votes
0
answers
112
views
0
answers
counting the reads mapped to specific coordinate in the genome
... I have RNA-seq data and aligned them to the genome, so I also have bam files. I also have the sequence of tRNA genes in the genome and corresponding coordinates. so, the question is that how can I count the number of reads that map to each coordinate separately in the genome. in other word, I want t ...
genome rna-seq written 22 days ago by alirezamomeni7070
2
votes
3
answers
166
views
6 follow
3
answers
trimming reads in fastq file
... I have a fastq file and at the beginning of all reads I have a "N". how can I get ride of that N using command line? here is an example: @SRR2163140.1 HISEQ:148:C670LANXX:3:1101:1302:1947 length=50 NGCGACCTCAGATCAGACGTGGCGACCTGGAATTCTCGGGTGCCAAGGAA +SRR2163140.1 HISEQ:148:C670LANXX:3:1 ...
rna-seq written 4 weeks ago by alirezamomeni7070 • updated 4 weeks ago by Charles Plessy1.8k
0
votes
0
answers
102
views
0
answers
Comment: C: alignment of sequencing data to the tRNA transcriptome
... here is the error I got after running this command: Error: Couldn't build bowtie index with err = 1 ...
written 4 weeks ago by alirezamomeni7070
0
votes
0
answers
102
views
0
answers
Comment: C: alignment of sequencing data to the tRNA transcriptome
... what tool do you suggest? actually I need to get bam file. ...
written 4 weeks ago by alirezamomeni7070
0
votes
0
answers
102
views
0
answers
Comment: C: alignment of sequencing data to the tRNA transcriptome
... I actually tried did not work. maybe my command was wrong. do you have an example? ...
written 4 weeks ago by alirezamomeni7070
1
vote
0
answers
102
views
0
answers
alignment of sequencing data to the tRNA transcriptome
... I have ribosome sequencing data and want to align it to the tRNA (not mRNA transcriptome). I have filtered out rRNA, non-coding RNAs and adapter. also I made tRNA indexes using bowtie2 (I have .bt2 files). now I want to align my data to the tRNA transcriptome. I have tried this command but did not ...
rna-seq written 4 weeks ago by alirezamomeni7070

Latest awards to alirezamomeni707

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 977 users visited in the last hour