User: Freek

gravatar for Freek
Freek10
Reputation:
10
Status:
New User
Location:
Netherlands
Last seen:
16 hours ago
Joined:
1 year, 5 months ago
Email:
f****@protonmail.ch

Biologist with a passion for technology.

Posts by Freek

<prev • 7 results • page 1 of 1 • next >
0
votes
0
answers
67
views
0
answers
RSEM BAM outputs, which one to use for RSeQC?
... Hi, I have used RSEM to estimate Transcript abundances in a sample. RSEM uses STAR to do the mapping (if asked) and optionally can output a BAM file where the reads are aligned against the genome and not the transcriptome (this genome file ends in .STAR.genome.bam and is generated with the option " ...
bam star rsem rseqc written 9 days ago by Freek10
1
vote
4
answers
52k
views
4
answers
Comment: C: What Does Samtools Flagstat Results Mean?
... Why did you skip n_mapped? Specifically, what is the minimum mapping Q of these mapped reads? Highest regards. ...
written 12 months ago by Freek10
0
votes
1
answer
1.5k
views
1
answers
Comment: C: Using the blast api from Python (3)
... Any tips on using Biopython then? If I do this: result_handle = NCBIWWW.qblast("blastn", "nt", 'gagtctcctttggaactctgcaggttctatttgctttttcccagatgagctctttttctggtgtttgtct') I get some XML output, when I want to print result_handle again, it is empty! How to save result for example? > Nev ...
written 17 months ago by Freek10
0
votes
1
answer
882
views
1
answers
Comment: C: How to get RID from blast rest api url using php
... I have the same issue, did you solve it? The response is always one long line of html. I want json which should be a valid FORMAT_TYPE yet I always get the same type of response back. ...
written 17 months ago by Freek10
0
votes
1
answer
1.5k
views
1
answers
Comment: C: Using the blast api from Python (3)
... By the way, what ever FORMAT_TYPE I use I get the same html/website as a response. ...
written 17 months ago by Freek10
0
votes
1
answer
1.5k
views
1
answers
Comment: C: Using the blast api from Python (3)
... Hi Gunnar, Thanx for your response. Hmm, before asking to install such things on our compute cluster I prefer this minimal approach. I will investigate bio-python, still I would prefer minimal, self made, flexible code and an easy to parse JSON response for portability, if anybody can get it to wor ...
written 17 months ago by Freek10
0
votes
1
answer
1.5k
views
1
answer
Using the blast api from Python (3)
... Hi all, I'm trying to use the blast api (https://blast.ncbi.nlm.nih.gov/Blast.cgi) from Python using the requests module. My goal is to send a sequence and get genomic (Ensembl GRCh38) coordinates back. request = 'https://blast.ncbi.nlm.nih.gov/Blast.cgi?QUERY=gagtctcctttggaactctgcaggttctatttg ...
python api blast python3 written 17 months ago by Freek10 • updated 17 months ago by Gunnar Schulze30

Latest awards to Freek

Popular Question 9 months ago, created a question with more than 1,000 views. For Using the blast api from Python (3)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1253 users visited in the last hour