Moderator: Dan D

gravatar for Dan D
Dan D6.2k
Reputation:
6,180
Status:
Trusted
Location:
Tennessee
Website:
http://automationdan.com/
Last seen:
an hour ago
Joined:
5 years, 7 months ago
Email:
d*******@gmail.com

Docendo discimus.

Posts by Dan D

<prev • 620 results • page 1 of 62 • next >
1
vote
1
answer
951
views
1
answers
Answer: A: Picard alignment statistics error
... I think the most likely explanation for the failure is the asterisk in place of the quality scores, which is a result of feeding FASTA data into the upstream alignment process. This is based on @Medhat 's information, the name of the BAM in @mia 's listed command which contains the word "scaffold", ...
written 9 days ago by Dan D6.2k
0
votes
1
answer
951
views
1
answers
Comment: C: Picard alignment statistics error
... Hmmm, there are no ASCII-encoded per-base quality scores in the result. I wonder if that's the problem. Here's what a read with those present would look like: ST-E00273:368:H57THCCXY:5:1106:4300:58268 99 chr1 9997 0 151M = 10329 430 ACCCTAACCCTAACCCTAACCCT ...
written 9 days ago by Dan D6.2k
0
votes
1
answer
951
views
1
answers
Comment: C: Picard alignment statistics error
... Those are the MAPQ scores for the read. I'm suggesting that the ASCII-encoded Phred quality scores are out of range. I'm basing that on the [source][1], specifically the `collectQualityData` method referenced in the trace. Would you mind posting the output of your command, minus the `cut`? [1]: ...
written 9 days ago by Dan D6.2k
0
votes
3
answers
204
views
3
answers
Answer: A: How to upload fasta file to SSH Supercomputer
... You can use SFTP through an FTP client like filezilla. There are command line clients as well but I'm not sure if you prefer command line or not. Use port 22 on the destination host. If you want to transfer over SSH, the `scp` command is what you want. For example, if you're on the host with the F ...
written 5 weeks ago by Dan D6.2k
0
votes
2
answers
228
views
2
answers
Answer: A: How to split a fastq file into each corresponding sample.fastq?
... The FASTX toolkit is way out of date, but I think [FASTX Barcode Splitter][1] may be what you need. As long as it works with your specific FASTQ format you're all set. [1]: http://hannonlab.cshl.edu/fastx_toolkit/commandline.html#fastx_barcode_splitter_usage ...
written 6 weeks ago by Dan D6.2k
1
vote
3
answers
336
views
3
answers
Answer: A: Demultiplexing bcl files into fastq files
... Picard has a BCL-to-FASTQ conversion tool that's not quite as robust as Illumina's proprietary tool. It might be worth a shot: https://broadinstitute.github.io/picard/command-line-overview.html#IlluminaBasecallsToFastq ...
written 7 weeks ago by Dan D6.2k
0
votes
1
answer
192
views
1
answers
Answer: A: Strand colour from BED file in IGV
... Look [here][1] at the third example. You can set a line in the header of your BED file to automatically color by strand. IGV should pick that up IIRC. [1]: http://hgwdev-kord.cse.ucsc.edu/FAQ/FAQformat.html#format1 ...
written 7 weeks ago by Dan D6.2k
2
votes
1
answer
309
views
1
answers
Answer: A: Is it possible to get VCF from two fastq files without reference genome?
... **No**. Variant calls are based on a reference genome sequence. Technically you could assemble the raw reads into a draft reference and variant call from *that*, but you'll still have to obtain some reference before you can perform variant calling. EDIT: I may be incorrect in the case that you're ...
written 7 weeks ago by Dan D6.2k
2
votes
1
answer
217
views
1
answers
Answer: A: Custom features in IGV
... The [IGV documentation][1] references the [official spec for GTF2][2]. That spec only allows for the following values: - `CDS` - `start_codon` - `stop_codon` - `exon` Granted, the GTF format is a special-case derivation of GFF so that's why it doesn't allow introns as a feature type. I'd think ...
written 7 weeks ago by Dan D6.2k
1
vote
2
answers
343
views
2
answers
Answer: A: Is there any software that can highlight or show the paired end reads within .sa
... If you're looking for an interactive visualization app, [Integrative Genomics Viewer][1] from the Broad can highlight many pairs at once. The same holds true for a similar program, [IGB][2]. [1]: http://software.broadinstitute.org/software/igv/ [2]: http://bioviz.org/igb/ ...
written 11 weeks ago by Dan D6.2k

Latest awards to Dan D

Teacher 23 hours ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Popular Question 6 days ago, created a question with more than 1,000 views. For Computational Biologist - Work with me at HudsonAlpha in Huntsville, USA
Teacher 5 weeks ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Scholar 7 weeks ago, created an answer that has been accepted. For A: Bwa or bowtie for mapping mulitple genomes
Appreciated 3 months ago, created a post with more than 5 votes. For A: what is in the fasta.fai
Good Answer 4 months ago, created an answer that was upvoted at least 5 times. For C: I want to re-open the old debate: python or perl ?
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Teacher 9 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Scholar 10 months ago, created an answer that has been accepted. For A: Bwa or bowtie for mapping mulitple genomes
Teacher 10 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Good Answer 12 months ago, created an answer that was upvoted at least 5 times. For C: I want to re-open the old debate: python or perl ?
Popular Question 15 months ago, created a question with more than 1,000 views. For Unable To Replicate Splice Junction In Tophat
Teacher 17 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Scholar 17 months ago, created an answer that has been accepted. For A: Bwa or bowtie for mapping mulitple genomes
Popular Question 19 months ago, created a question with more than 1,000 views. For Unable To Replicate Splice Junction In Tophat
Teacher 19 months ago, created an answer with at least 3 up-votes. For A: Getting Started With Ngs Analysis For Modeling Guy
Scholar 19 months ago, created an answer that has been accepted. For A: Bwa or bowtie for mapping mulitple genomes
Teacher 19 months ago, created an answer with at least 3 up-votes. For A: Getting Started With Ngs Analysis For Modeling Guy
Scholar 20 months ago, created an answer that has been accepted. For A: Bwa or bowtie for mapping mulitple genomes
Appreciated 20 months ago, created a post with more than 5 votes. For A: what is in the fasta.fai
Scholar 20 months ago, created an answer that has been accepted. For A: what is in the fasta.fai

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1428 users visited in the last hour