Moderator: Dan D

gravatar for Dan D
Dan D6.7k
Reputation:
6,740
Status:
Trusted
Location:
Tennessee
Website:
http://automationdan.com/
Last seen:
16 hours ago
Joined:
7 years ago
Email:
d*******@gmail.com

Docendo discimus.

Posts by Dan D

<prev • 643 results • page 1 of 65 • next >
1
vote
2
answers
365
views
2
answers
Answer: A: using bash variable in picard MarkDuplicates command
... The problem is not totally with your usage of variables. You're pointing Picard to the wrong location for the BAM (from the Picard output you pasted in the comment): Exception in thread "main" htsjdk.samtools.SAMException: Cannot read non-existent file: file:///home/cmccabe/NA12878.bam In your ...
written 7 months ago by Dan D6.7k
0
votes
0
answers
480
views
0
answers
Job: Work with me at HudsonAlpha Institute for Biotechnology in Huntsville, AL
... If you want to swim in a bottomless sea of sequencing data and have access to a wide variety of interesting projects in the bioinformatics/big data/data science space, this is for you. You'll be working with me on a growing team solving a number of fun challenges with lots of freedom to utilize new ...
job written 9 months ago by Dan D6.7k
0
votes
0
answers
48
views
0
answers
Comment: C: Marketing Project Manager
... Hello Sheila.Smaw! We believe that this post does not fit the main topic of this site. This is not related to bioinformatics For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with. If you disagree please tell us why ...
written 10 months ago by Dan D6.7k
0
votes
0
answers
289
views
0
answers
Comment: C: Associate Office Manager, Qiagen, Cary, NC, USA
... Hello Sheila.Smaw! We believe that this post does not fit the main topic of this site. This position is not bioinformatics-related. For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with. If you disagree please tell ...
written 10 months ago by Dan D6.7k
0
votes
1
answer
566
views
1
answers
Comment: C: Is there any precedent for considering marked duplicates when calculating covera
... OK, I ran it and with the default of mismatch of two it found dup rates between 38-42% on a set of four paired-end datasets. After thinking on this for a bit I come back to my core premise: it's entirely possible that these are not duplicates because of the hundreds of millions of input reads and th ...
written 10 months ago by Dan D6.7k
0
votes
1
answer
566
views
1
answers
Comment: C: Is there any precedent for considering marked duplicates when calculating covera
... Oh, right, I didn't address that in my reply. I will give it a try right now. ...
written 10 months ago by Dan D6.7k
0
votes
1
answer
566
views
1
answers
Comment: C: Is there any precedent for considering marked duplicates when calculating covera
... @finswimmer. This is a standard whole-exome library prep with tight insert size distribution around 225. The duplicate rate is showing between 25-30% from the 200X-targeted and 40-45% for the 400X targeted. I'm looking to report an accurate coverage estimate per library which appropriately considers ...
written 10 months ago by Dan D6.7k
8
votes
1
answer
566
views
5 follow
1
answer
Is there any precedent for considering marked duplicates when calculating coverage in high-depth whole-exome sequencing?
... I'm working with some high-depth whole-exome sequencing data. It's paired-end. Some samples are targeted at 200X and others are 400X average read depth across the exome. The duplicate rate is very high after alignment. I suspect a good portion of these marked duplicates are not actual PCR duplicates ...
exome duplicates exome-seq coverage written 10 months ago by Dan D6.7k • updated 4 months ago by marco_ul0
1
vote
2
answers
357
views
2
answers
Answer: A: Removing Indices using Cutadapt
... OK, so let's look at a typical FASTQ read: @E00777:238:HABCDCCXY:1:1101:7770:2294 1:N:0:AGCGAAC ACAGTTGTCCAGTGGCAACAAGGACTCAAGAGATAGAAGACTGATATTATGGTATTTTGAACACCAGCTGAAACCCTTAGTGGCCGAATTTGTGCAGGTCT + -AAFFJJJJJF7AFJJAJJJJJAFJJJJ--FF-FF- ...
written 10 months ago by Dan D6.7k
0
votes
1
answer
392
views
1
answers
Comment: C: s. pombe alignment
... Can you please post the command lines you used? ...
written 11 months ago by Dan D6.7k

Latest awards to Dan D

Good Answer 5 months ago, created an answer that was upvoted at least 5 times. For C: I want to re-open the old debate: python or perl ?
Popular Question 6 months ago, created a question with more than 1,000 views. For Has anyone tried the new LFQC compression scheme for FASTQ?
Teacher 7 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Appreciated 8 months ago, created a post with more than 5 votes. For A: what is in the fasta.fai
Popular Question 10 months ago, created a question with more than 1,000 views. For Has anyone tried the new LFQC compression scheme for FASTQ?
Popular Question 11 months ago, created a question with more than 1,000 views. For Computational Biologist - Work with me at HudsonAlpha in Huntsville, USA
Popular Question 14 months ago, created a question with more than 1,000 views. For Computational Biologist - Work with me at HudsonAlpha in Huntsville, USA
Great Question 15 months ago, created a question with more than 5,000 views. For Anyone Have Suggestions For De Novo Assembly Of A Genome From Miseq 250 Pe Data?
Teacher 15 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Teacher 16 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Popular Question 17 months ago, created a question with more than 1,000 views. For Computational Biologist - Work with me at HudsonAlpha in Huntsville, USA
Teacher 17 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Popular Question 17 months ago, created a question with more than 1,000 views. For Computational Biologist - Work with me at HudsonAlpha in Huntsville, USA
Teacher 18 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Scholar 19 months ago, created an answer that has been accepted. For A: Bwa or bowtie for mapping mulitple genomes
Appreciated 20 months ago, created a post with more than 5 votes. For A: what is in the fasta.fai
Good Answer 21 months ago, created an answer that was upvoted at least 5 times. For C: I want to re-open the old debate: python or perl ?
Teacher 21 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Popular Question 22 months ago, created a question with more than 1,000 views. For Is There An Explanation For This Tophat "Yt" Descriptor Discrepancy In My Sam Output?
Teacher 23 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Teacher 2.2 years ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1934 users visited in the last hour