Moderator: Dan D

gravatar for Dan D
Dan D6.4k
Reputation:
6,440
Status:
Trusted
Location:
Tennessee
Website:
http://automationdan.com/
Last seen:
29 minutes ago
Joined:
6 years, 2 months ago
Email:
d*******@gmail.com

Docendo discimus.

Posts by Dan D

<prev • 641 results • page 1 of 65 • next >
0
votes
0
answers
47
views
0
answers
Comment: C: Marketing Project Manager
... Hello Sheila.Smaw! We believe that this post does not fit the main topic of this site. This is not related to bioinformatics For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with. If you disagree please tell us why ...
written 5 days ago by Dan D6.4k
0
votes
0
answers
94
views
0
answers
Comment: C: Associate Office Manager, Qiagen, Cary, NC, USA
... Hello Sheila.Smaw! We believe that this post does not fit the main topic of this site. This position is not bioinformatics-related. For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with. If you disagree please tell ...
written 12 days ago by Dan D6.4k
0
votes
0
answers
159
views
0
answers
Comment: C: Is there any precedent for considering marked duplicates when calculating covera
... OK, I ran it and with the default of mismatch of two it found dup rates between 38-42% on a set of four paired-end datasets. After thinking on this for a bit I come back to my core premise: it's entirely possible that these are not duplicates because of the hundreds of millions of input reads and th ...
written 13 days ago by Dan D6.4k
0
votes
0
answers
159
views
0
answers
Comment: C: Is there any precedent for considering marked duplicates when calculating covera
... Oh, right, I didn't address that in my reply. I will give it a try right now. ...
written 13 days ago by Dan D6.4k
0
votes
0
answers
159
views
0
answers
Comment: C: Is there any precedent for considering marked duplicates when calculating covera
... @finswimmer. This is a standard whole-exome library prep with tight insert size distribution around 225. The duplicate rate is showing between 25-30% from the 200X-targeted and 40-45% for the 400X targeted. I'm looking to report an accurate coverage estimate per library which appropriately considers ...
written 13 days ago by Dan D6.4k
7
votes
0
answers
159
views
0
answers
Is there any precedent for considering marked duplicates when calculating coverage in high-depth whole-exome sequencing?
... I'm working with some high-depth whole-exome sequencing data. It's paired-end. Some samples are targeted at 200X and others are 400X average read depth across the exome. The duplicate rate is very high after alignment. I suspect a good portion of these marked duplicates are not actual PCR duplicates ...
exome duplicates exome-seq coverage written 13 days ago by Dan D6.4k
1
vote
2
answers
76
views
2
answers
Answer: A: Removing Indices using Cutadapt
... OK, so let's look at a typical FASTQ read: @E00777:238:HABCDCCXY:1:1101:7770:2294 1:N:0:AGCGAAC ACAGTTGTCCAGTGGCAACAAGGACTCAAGAGATAGAAGACTGATATTATGGTATTTTGAACACCAGCTGAAACCCTTAGTGGCCGAATTTGTGCAGGTCT + -AAFFJJJJJF7AFJJAJJJJJAFJJJJ--FF-FF- ...
written 18 days ago by Dan D6.4k
0
votes
1
answer
109
views
1
answers
Comment: C: s. pombe alignment
... Can you please post the command lines you used? ...
written 4 weeks ago by Dan D6.4k
0
votes
4
answers
286
views
4
answers
Comment: C: IGV command line control
... Have you seen these? http://software.broadinstitute.org/software/igv/PortCommands http://software.broadinstitute.org/software/igv/batch ...
written 12 weeks ago by Dan D6.4k
0
votes
4
answers
3.6k
views
4
answers
Comment: C: Illumina Instrument Type from fastq?
... Every NovaSeq serial I've seen has been of the form `^A\d{5}$` (five, not six digits). That's just at one site though. ...
written 3 months ago by Dan D6.4k

Latest awards to Dan D

Popular Question 29 days ago, created a question with more than 1,000 views. For Has anyone tried the new LFQC compression scheme for FASTQ?
Popular Question 6 weeks ago, created a question with more than 1,000 views. For Computational Biologist - Work with me at HudsonAlpha in Huntsville, USA
Popular Question 4 months ago, created a question with more than 1,000 views. For Computational Biologist - Work with me at HudsonAlpha in Huntsville, USA
Great Question 5 months ago, created a question with more than 5,000 views. For Anyone Have Suggestions For De Novo Assembly Of A Genome From Miseq 250 Pe Data?
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Teacher 6 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Popular Question 7 months ago, created a question with more than 1,000 views. For Computational Biologist - Work with me at HudsonAlpha in Huntsville, USA
Teacher 7 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Popular Question 7 months ago, created a question with more than 1,000 views. For Computational Biologist - Work with me at HudsonAlpha in Huntsville, USA
Teacher 8 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Scholar 9 months ago, created an answer that has been accepted. For A: Bwa or bowtie for mapping mulitple genomes
Appreciated 10 months ago, created a post with more than 5 votes. For A: what is in the fasta.fai
Good Answer 11 months ago, created an answer that was upvoted at least 5 times. For C: I want to re-open the old debate: python or perl ?
Teacher 11 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Popular Question 12 months ago, created a question with more than 1,000 views. For Is There An Explanation For This Tophat "Yt" Descriptor Discrepancy In My Sam Output?
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Teacher 16 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Scholar 17 months ago, created an answer that has been accepted. For A: Bwa or bowtie for mapping mulitple genomes
Teacher 17 months ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes
Good Answer 19 months ago, created an answer that was upvoted at least 5 times. For C: I want to re-open the old debate: python or perl ?
Popular Question 23 months ago, created a question with more than 1,000 views. For Unable To Replicate Splice Junction In Tophat
Teacher 2.0 years ago, created an answer with at least 3 up-votes. For A: Bwa or bowtie for mapping mulitple genomes

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1946 users visited in the last hour