User: verne91

gravatar for verne91
verne9110
Reputation:
10
Status:
New User
Location:
Last seen:
1 year, 6 months ago
Joined:
1 year, 7 months ago
Email:
v******@gmail.com

Posts by verne91

<prev • 9 results • page 1 of 1 • next >
1
vote
0
answers
486
views
0
answers
Comment: C: What does 'TLEN' in BAM file mean if mate pairs aligned to different chromosomes
... 10X staff today told me the TLEN is meaningless if the pairs aligned to different chromosomes. ...
written 19 months ago by verne9110
0
votes
2
answers
1.9k
views
2
answers
Comment: C: Sorting .bam file by tag
... There is no BX*.sam, because `OUTPUT=substr($0,RSTART+5,18)` ...
written 19 months ago by verne9110
0
votes
0
answers
486
views
0
answers
Comment: C: What does 'TLEN' in BAM file mean if mate pairs aligned to different chromosomes
... I added the '@PG' tag. So the aligner and parameters are there. ...
written 19 months ago by verne9110
1
vote
0
answers
486
views
0
answers
What does 'TLEN' in BAM file mean if mate pairs aligned to different chromosomes?
... for example: E00247:267:HMVT3CCXX:2:1208:32603:44398 161 chr1 29691910 25 23M4I37M87S chrUn_gl000220 133398 -307 TTCTCTCTCTGTCTGTCTCTTTCTGCTTCTCTCTCTCTCTCTCTCTCTCCCTCTCTCTCTCTCTTTCTGCTCCTCTCTCTTTCTGTTTGTTTCTCTCCCTGTCGTTCTCCCCCCCCTCCTGTCCCTCTTTCTCTCTCTCTCGCTTCCTTGT AA ...
alignment bam written 19 months ago by verne9110
0
votes
1
answer
525
views
1
answers
Comment: C: Why some entries from a same pair in the bam file have different TLEN?
... How can I calculate the insert size for each entry if I don't use TLEN? just use (rightmost coordinate)-(leftmost coordinate)+1? ...
written 19 months ago by verne9110
0
votes
1
answer
525
views
1
answers
Comment: C: Why some entries from a same pair in the bam file have different TLEN?
... I am sorry I made another mistake. I have added the previous example. Would TLEN be set 0 if the pairs mapped to different chromosomes? ...
written 19 months ago by verne9110
0
votes
1
answer
525
views
1
answers
Comment: C: Why some entries from a same pair in the bam file have different TLEN?
... I am very sorry that I took an wrong example. I have updated the example. I think the problem maybe have something to do with hard clipping. ...
written 19 months ago by verne9110
2
votes
1
answer
525
views
5 follow
1
answer
Why some entries from a same pair in the bam file have different TLEN?
... E00247:267:HMVT3CCXX:4:2219:5172:54541 321 chr1 199910236 45 85H43M chrUn_gl000220 136768 -235 AGAGAGCAAGAAAAAGAAAGAGAGAGAGAGAGAGAGAGAGACA ,7,,,A,,7,A,A,A,A7FAFF,AAF7,, ...
genome 10x alignment bam sequencing written 19 months ago by verne9110
0
votes
4
answers
18k
views
4
answers
Comment: C: Estimating Insert Size From Paired End Data.
... Why do you subtract the read length in the fourth step? Do the insert size include the read length? https://www.biostars.org/p/95803/ ...
written 19 months ago by verne9110

Latest awards to verne91

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1940 users visited in the last hour