User: csjlee08

gravatar for csjlee08
csjlee0810
Reputation:
10
Status:
New User
Location:
Last seen:
5 months, 4 weeks ago
Joined:
1 year, 6 months ago
Email:
c*******@gmail.com

Posts by csjlee08

<prev • 16 results • page 1 of 2 • next >
0
votes
0
answers
507
views
0
answers
Sequence read and quality do not match - Trimmomatic
... Hi, I am working with GBS data. I have demultiplexed the reads and am trying to trim the adapters using Trimmomatic. The error I get is: java.lang.RuntimeException: Sequence and quality length don't match: 'TGCAGCCCAAAACAAAAACTCGAATTGAAAAGTGGGAGTTTGAGGCGAAGAAAGAGACCGAGATCGGAAGAGCGGTTCAGCAGGAATG ...
ngs gbs written 10 months ago by csjlee0810
0
votes
0
answers
356
views
0
answers
GBS pipeline POD Error: does not exist or is unreadable
... Hello, I am trying to use GBS-POD pipeline, having trouble with the system to find my files although I did specify the file paths in the script, and they are in the current working directory. This is the command and error: greg@Genomics:/media/greg/StorageD/gbs3/GBSpipeline$ sudo ./GBS_ ...
pipeline gbs written 10 months ago by csjlee0810
0
votes
0
answers
406
views
0
answers
Error uploading VCF file onto Tassel v5
... Hello, I am trying to upload my VCF file from my GBS data onto Tasselv5. I am unable to upload it because I get the following error: [AWT-EventQueue-0] DEBUG net.maizegenetics.tassel.TASSELMainFrame - Problem loading file: /media/greg/Overflow/fastgbs/fastgbsfile/Platypus_0.8.1/AllVariants.sort ...
tassel gbs written 11 months ago by csjlee0810 • updated 11 months ago by RamRS20k
1
vote
0
answers
427
views
0
answers
Comment: C: Platypus-VCF caller - Segmentation fault (core dumped)
... Thanks! I managed to solve the problem by specifying nCPU=12. ...
written 12 months ago by csjlee0810
1
vote
0
answers
427
views
0
answers
Platypus-VCF caller - Segmentation fault (core dumped)
... Hello - I am trying to run a program which is a variant caller called Platypus: https://github.com/andyrimmer/Platypus It appears to be running okay but then I get the error Segmentation fault (core dumped). I've tried to backtrace it but I am new to bioinformatics shttps://github.com/andyrimmer/P ...
variant calling next-gen platypus gbs written 12 months ago by csjlee0810 • updated 12 months ago by Kevin Blighe37k
0
votes
0
answers
355
views
0
answers
GBS Pipeline POD - Error: unexpected number of columns in *.txt: 97
... Hello I am using the demultiplex/variant caller pipeline for GBS called GBS-POD \\https://github.com/carolyncaron/GBSpipeline/wiki/GBS-pipeline-POD I keep running into this error: greg@Genomics:/media/greg/Overflow/gbs3/GBSpipeline$ ./GBS_pipeline.pl demultiplex Adzuki_ExB_Plate1 indextopsbottoms.t ...
pod gbs written 14 months ago by csjlee0810
0
votes
0
answers
1.3k
views
0
answers
Comment: C: Confusion about barcodes and removal
... https://github.com/najoshi/sabre/commit/2a1bedc9a53fd03420d7a3b11f406efa60f90ba1 Check this out it looks like there is an option : --h, --both-barcodes, Optional flag that indicates that both fastq files have barcodes.\n\ +-c, --both-barcodes, Optional flag that indicates that both fastq files hav ...
written 14 months ago by csjlee0810
0
votes
0
answers
1.2k
views
0
answers
import runner ImportError: No module named runner
... Hello I'm trying to run Fast-GBS which runs Platypus. I keep getting the following: Search the variants with platypus Traceback (most recent call last): File "Platypus.py", line 9, in import runner ImportError: No module named runner !!! There is a problem at the platypus step **I think th ...
fast-gbs platypus written 14 months ago by csjlee0810 • updated 13 months ago by Biostar ♦♦ 20
0
votes
0
answers
760
views
0
answers
Comment: C: Platypus install - build problems
... New error: Search the variants with platypus Traceback (most recent call last): File "Platypus.py", line 9, in import runner ImportError: No module named runner ...
written 14 months ago by csjlee0810
0
votes
0
answers
760
views
0
answers
Comment: C: Platypus install - build problems
... Building Platypus running build running build_py running build running build_py running build running build_py running build running build_py running build running build_py running build running build_py running build running build_py r ...
written 14 months ago by csjlee0810 • updated 14 months ago by genomax62k

Latest awards to csjlee08

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1606 users visited in the last hour