User: hersh

gravatar for hersh
hersh0
Reputation:
0
Status:
New User
Last seen:
2 days, 10 hours ago
Joined:
1 year, 4 months ago
Email:
e**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by hersh

<prev • 9 results • page 1 of 1 • next >
0
votes
2
answers
104
views
2
answers
Comment: C: Best tools to search for and report all alignments
... Thanks for the response. I will take a look at segemehl for my analysis, and I appreciate the additional links and info. ...
written 2 days ago by hersh0
2
votes
2
answers
104
views
2
answers
Best tools to search for and report all alignments
... I am looking to align a fastq file of 50mer sequences against a reference genome. I am looking to return ALL possible alignments, not just the best alignments. I looked at using Bowtie2 with the -a flag, however in the documenation it says "Some tools are designed with this reporting mode in mind. B ...
alignment sequence written 3 days ago by hersh0 • updated 3 days ago by Biogeek310
0
votes
1
answer
231
views
1
answers
Comment: C: Efficiently performing intersections for multiple subsets of a BED file
... for A.bed: chr15^I3057295^I3057329^IGGGCACTGAAACCCCATGATGCTGCTGTCAGCTTG^I46.85$ chr15^I3089214^I3089250^ITTTTCTCTGTGAGACCTGATAGGGATCCAAAGGAGGA^I42.31$ chr15^I3105599^I3105635^IGGACCTTAGCATGACTGTGCTACTCTCTGTTTAGTGC^I42.41$ chr15^I3130755^I3130794^ICATGTTTTGCAGTGTGAGGATGTGTTTAAGGTTACCTGTG^I42.19$ chr ...
written 12 weeks ago by hersh0
0
votes
1
answer
231
views
1
answers
Comment: C: Efficiently performing intersections for multiple subsets of a BED file
... It prints the gene IDs without any weird endings ...
written 12 weeks ago by hersh0
0
votes
1
answer
231
views
1
answers
Comment: C: Efficiently performing intersections for multiple subsets of a BED file
... XR_001781769.1$ XM_006520483.3$ NM_010601.3$ XM_006520484.2$ NM_016766.3$ NM_001164156.1$ XR_001781768.1$ XR_384436.3$ XR_384437.3$ XR_384438.3$ ...
written 12 weeks ago by hersh0 • updated 12 weeks ago by Alex Reynolds26k
0
votes
1
answer
231
views
1
answers
Comment: C: Efficiently performing intersections for multiple subsets of a BED file
... I installed awk using brew and now get "awk: can't open file -vgene=cat source line number 1 awk: syntax error at source line 1 context is >>> genes. <<< txt" ...
written 12 weeks ago by hersh0
0
votes
1
answer
231
views
1
answers
Comment: C: Efficiently performing intersections for multiple subsets of a BED file
... Hey Alex thanks for your answer. I dowloaded bedops, and tried running the bash commands in your answer, but unfortunately I am getting the following error "awk: can't open file -vgene=cat source line number 1 awk: invalid -v option". I put the genes in a text file with one ID per line. Thanks, once ...
written 12 weeks ago by hersh0
0
votes
1
answer
231
views
1
answer
Efficiently performing intersections for multiple subsets of a BED file
... My goal is to find an efficient way to do multiple intersections very quickly. Here is my problem: I am looking to do the equivalent operation to `intersectBed -a file1.bed -b file2.bed` except that I would like to do this for ~4000 different genes in file2.bed, and then store the results in a dict ...
sequence written 12 weeks ago by hersh0 • updated 12 weeks ago by Alex Reynolds26k
0
votes
0
answers
661
views
0
answers
creating graph of distribution of blast hits on the query sequence
... Hi Biostars, I'm attempting to visualize the results of my BLAST search in a way similar to the graphical display of the distribution of blast hits from the web BLAST. For example, from my BLAST search: [![enter image description here][1]][1] except I would like the graph to contain information ...
R blast written 16 months ago by hersh0

Latest awards to hersh

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1484 users visited in the last hour