User: eennadi

gravatar for eennadi
eennadi0
Reputation:
0
Status:
New User
Last seen:
4 days ago
Joined:
2 months, 4 weeks ago
Email:
e******@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by eennadi

<prev • 6 results • page 1 of 1 • next >
0
votes
0
answers
115
views
0
answers
Comment: C: How to produce a consensus genome
... Am so sorry for using Caps ...
written 4 days ago by eennadi0
1
vote
0
answers
115
views
5 follow
0
answers
How to produce a consensus genome
... I have two sequences I wish to assemble to give a consensus genome. I am using Velvet assembler would this command line be OK ./velveth conref_out 35 -fastq.gz -shortPaired -separate \ /Users/emmannaemeka/Desktop/QTL_ANALYSIS/Trimmomatic-0.36/EN28FP.fq.gz \ //Users/emmannaemek ...
genome assembly next-gen sequence sequencing written 4 days ago by eennadi0 • updated 4 days ago by Ram12k
0
votes
2
answers
1.7k
views
2
answers
Answer: A: Preparing A Scaffolded Genome For Genbank Submission
... I have been trying to use GAG to prepare my genome for submission. I generated the Gff file using maker but when I run it on GAG it tells me no parent How do I solve this? ...
written 5 weeks ago by eennadi0
0
votes
0
answers
133
views
0
answers
Merging GFF from two different MAKER runs
... I am trying to annotate my genome assembly using Maker. I have thousands of contigs, i discovered that few contigs failed during annotation. Since I can't begin a fresh annotation, I selected all the contigs that failed and ran maker on them. now i want to merge off using gff3_merge gff3_merge -d ...
assembly alignment written 5 weeks ago by eennadi0
0
votes
1
answer
168
views
1
answer
Removing running backlash from my fasta sequences
... Please how do i remove a running backslash that divides my sequences into half? \TTTATAAATTGATGGGGTGGATGAATTCAGACTCATTATTATGATATACTTTATTTTAT T\TTATTTTTCTTCTTTTTACATGTACATTGAGAAAAAATAAAGTATACAAATTCATCTC AA\AGCATTATATGACTTTAACATATATGACTTTTATGATATTTAAATGTTATTAAAAAT ATA\AAAATATACTACTCGATCATAAAAATATT ...
assembly written 5 weeks ago by eennadi0 • updated 5 weeks ago by Ram12k
0
votes
0
answers
166
views
0
answers
Difficulty in installing MAKER
... Hi all, I have been trying to install MAKER gene prediction software. I have installed all the dependences but when i run ./BUILD INSTALL I keep getting this message emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop ...
genome assembly software error written 12 weeks ago by eennadi0 • updated 12 weeks ago by genomax37k

Latest awards to eennadi

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1342 users visited in the last hour