User: Ambika

gravatar for Ambika
Ambika30
Reputation:
30
Status:
New User
Location:
United States/Auburn/Auburn University
Last seen:
3 days, 17 hours ago
Joined:
1 year, 10 months ago
Email:
a***************@gmail.com

Posts by Ambika

<prev • 94 results • page 1 of 10 • next >
0
votes
1
answer
75
views
1
answers
Comment: C: how to download cazy database
... @Dattatray I was following the link on their paper. I did not know they moved it. Now it works. Thanks a lot. ...
written 7 days ago by Ambika30
3
votes
1
answer
75
views
1
answer
how to download cazy database
... Hey Biostars, I am trying to download [Cazy][1] database, but I could not find a place where I can download. I also tried another program [dbcan][2] but the site they provided does not seem to open. Thank you, Ambika [1]: http://www.cazy.org/ [2]: http://cys.bios.niu.edu/dbCAN2 ...
database cazymes written 7 days ago by Ambika30 • updated 7 days ago by Dattatray Mongad320
0
votes
4
answers
181
views
4
answers
Comment: C: Remove double vertical bar "||" at the end of the sequence in a fasta file
... Thanks you so much it works. ...
written 15 days ago by Ambika30
21
votes
4
answers
181
views
7 follow
4
answers
Remove double vertical bar "||" at the end of the sequence in a fasta file
... Hello I have a fasta file as >jgi|FusspF23_1|104542 GGTTCTCTTGTCTGTTTTTAAAAGAGTCTCGAGACCCC|| >jgi|FusspF23_1|10121 GGGGCCGCCCTCGATTCATCAGCGAAATTGCTCAGTCGGGCG|| at the end of fasta sequence I have these symbols `"||"` which I want to remove. I tried using *sed* but in that wa ...
fasta sed awk written 16 days ago by Ambika30 • updated 16 days ago by SMK1.8k
0
votes
0
answers
142
views
0
answers
Comment: C: Parsing a fasta file
... I think I figure it out with the sed command. I just replaced the space that I had with that output.fa file with a line using this code. sed 's/\t/\n/g' output.fa> output1.fa >jgi|Necha2|9923|gw1.3.792.1 CGTGGCCAGGCTCTTTATATTCGCTCACTCTTCGAGGCCAACCGCAATGTGACTGATCCGAGACACCAAAGAGCT ...
written 23 days ago by Ambika30
0
votes
0
answers
142
views
0
answers
Comment: C: Parsing a fasta file
... I tried this awk command awk '/^>/ {printf("%s%s\t",(N>0?"\n":""),$0);N++;next;} {printf("%s",$0);} END {printf("\n");}' < input_best_transcripts.fasta > output.fa It gives me the fasta file with single line >jgi|Necha2|9923|gw1.3.792.1 CGTGGCCAGGCTCTTTATATTCGCT ...
written 23 days ago by Ambika30
0
votes
0
answers
142
views
0
answers
Parsing a fasta file
... Hello everyone, I have a fasta file like this in multiple lines >jgi|Necha2|9923|gw1.3.792.1 CGTGGCCAGGCTCTTTATATTCGCTCACTCTTCGAGGCCAACCGCAATGTGACTGATCCGAGACACCAAA GAGCTCTGTTGACGGAGACAGAGAAGCTACTGGAGAGCTGGAAGCACCCCGATCCCTACACGCCCCCGAC TGCTCCCGGAGGCTCAAAGTTCGAGCGAAACCTGCCATCG ...
assembly sequence written 23 days ago by Ambika30
0
votes
0
answers
778
views
0
answers
Comment: C: qPCR: Huge variation in fold change of genes between biological replicates
... @Kevin I am just using cDNA to amplify the genes. I did not apply any whole genome amplification ...
written 13 months ago by Ambika30
0
votes
0
answers
778
views
0
answers
Comment: C: qPCR: Huge variation in fold change of genes between biological replicates
... @Kevin Yes I am using ∆∆Ct method to determine the fold change. I collected all my biological samples the same day in order to minimize the variation, and of course the treatments and conditions are same. Even my technical replicates look fine. So, I am having hard time figuring out what is the actu ...
written 13 months ago by Ambika30
0
votes
0
answers
778
views
0
answers
Comment: C: qPCR: Huge variation in fold change of genes between biological replicates
... i already checked the degradation by running gel on my RNA samples before and after DNAse treatment. They look fine. ...
written 13 months ago by Ambika30

Latest awards to Ambika

Supporter 7 days ago, voted at least 25 times.
Popular Question 12 months ago, created a question with more than 1,000 views. For Deseq2 library load error
Popular Question 12 months ago, created a question with more than 1,000 views. For Unable to access jarfile trimmomatic-0.35
Popular Question 12 months ago, created a question with more than 1,000 views. For HTseq Pysam error
Popular Question 12 months ago, created a question with more than 1,000 views. For Trimmomatic jar file
Popular Question 12 months ago, created a question with more than 1,000 views. For Interpretation of Results from trimmomatic
Popular Question 12 months ago, created a question with more than 1,000 views. For HTseq error: Too few arguements
Popular Question 12 months ago, created a question with more than 1,000 views. For DESeq2 workflow for RNAseq
Popular Question 12 months ago, created a question with more than 1,000 views. For Feature Counts output interpretation
Popular Question 15 months ago, created a question with more than 1,000 views. For Unable to access jarfile trimmomatic-0.35
Rising Star 20 months ago, created 50 posts within first three months of joining.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1905 users visited in the last hour