User: Ambika

gravatar for Ambika
Ambika30
Reputation:
30
Status:
New User
Location:
United States/Auburn/Auburn University
Last seen:
4 weeks ago
Joined:
2 years, 3 months ago
Email:
a***************@gmail.com

Posts by Ambika

<prev • 96 results • page 1 of 10 • next >
0
votes
1
answer
71
views
1
answer
Interpreting co-ordinates file
... Hello everyone, I got the coordinate file after aligning my query genome file to the reference genome file using MUMmer. Now I want to distinguish core and accessory genome using that coordinate file. But I do not know how I can do that. The coordinate file looks like this: [S1] [E ...
genome alignment written 28 days ago by Ambika30 • updated 28 days ago by Mensur Dlakic2.5k
0
votes
0
answers
84
views
0
answers
Mummer for running multiple query files
... Hello everyone, I am trying to use Mummer to differentiate core and accessory chromosomes in some genome assembly files I have. I used the following code to align single query file to the single reference file which seems to work fine. nucmer -maxmatch -c 100 -p Fop Fol_fasta Fusox.fasta ...
assembly mummer alignment nucmer written 4 weeks ago by Ambika30
0
votes
1
answer
290
views
1
answers
Comment: C: how to download cazy database
... @Dattatray I was following the link on their paper. I did not know they moved it. Now it works. Thanks a lot. ...
written 5 months ago by Ambika30
3
votes
1
answer
290
views
1
answer
how to download cazy database
... Hey Biostars, I am trying to download [Cazy][1] database, but I could not find a place where I can download. I also tried another program [dbcan][2] but the site they provided does not seem to open. Thank you, Ambika [1]: http://www.cazy.org/ [2]: http://cys.bios.niu.edu/dbCAN2 ...
database cazymes written 5 months ago by Ambika30 • updated 5 months ago by Dattatray Mongad340
0
votes
4
answers
289
views
4
answers
Comment: C: Remove double vertical bar "||" at the end of the sequence in a fasta file
... Thanks you so much it works. ...
written 5 months ago by Ambika30
21
votes
4
answers
289
views
7 follow
4
answers
Remove double vertical bar "||" at the end of the sequence in a fasta file
... Hello I have a fasta file as >jgi|FusspF23_1|104542 GGTTCTCTTGTCTGTTTTTAAAAGAGTCTCGAGACCCC|| >jgi|FusspF23_1|10121 GGGGCCGCCCTCGATTCATCAGCGAAATTGCTCAGTCGGGCG|| at the end of fasta sequence I have these symbols `"||"` which I want to remove. I tried using *sed* but in that wa ...
fasta sed awk written 5 months ago by Ambika30 • updated 5 months ago by SMK1.9k
0
votes
0
answers
211
views
0
answers
Comment: C: Parsing a fasta file
... I think I figure it out with the sed command. I just replaced the space that I had with that output.fa file with a line using this code. sed 's/\t/\n/g' output.fa> output1.fa >jgi|Necha2|9923|gw1.3.792.1 CGTGGCCAGGCTCTTTATATTCGCTCACTCTTCGAGGCCAACCGCAATGTGACTGATCCGAGACACCAAAGAGCT ...
written 5 months ago by Ambika30
0
votes
0
answers
211
views
0
answers
Comment: C: Parsing a fasta file
... I tried this awk command awk '/^>/ {printf("%s%s\t",(N>0?"\n":""),$0);N++;next;} {printf("%s",$0);} END {printf("\n");}' < input_best_transcripts.fasta > output.fa It gives me the fasta file with single line >jgi|Necha2|9923|gw1.3.792.1 CGTGGCCAGGCTCTTTATATTCGCT ...
written 5 months ago by Ambika30
0
votes
0
answers
211
views
0
answers
Parsing a fasta file
... Hello everyone, I have a fasta file like this in multiple lines >jgi|Necha2|9923|gw1.3.792.1 CGTGGCCAGGCTCTTTATATTCGCTCACTCTTCGAGGCCAACCGCAATGTGACTGATCCGAGACACCAAA GAGCTCTGTTGACGGAGACAGAGAAGCTACTGGAGAGCTGGAAGCACCCCGATCCCTACACGCCCCCGAC TGCTCCCGGAGGCTCAAAGTTCGAGCGAAACCTGCCATCG ...
assembly sequence written 5 months ago by Ambika30
0
votes
0
answers
1.0k
views
0
answers
Comment: C: qPCR: Huge variation in fold change of genes between biological replicates
... @Kevin I am just using cDNA to amplify the genes. I did not apply any whole genome amplification ...
written 17 months ago by Ambika30

Latest awards to Ambika

Popular Question 4 months ago, created a question with more than 1,000 views. For Cufflinks gtf file to htseq
Popular Question 4 months ago, created a question with more than 1,000 views. For DESeq2 workflow for RNAseq
Supporter 5 months ago, voted at least 25 times.
Popular Question 17 months ago, created a question with more than 1,000 views. For Deseq2 library load error
Popular Question 17 months ago, created a question with more than 1,000 views. For Unable to access jarfile trimmomatic-0.35
Popular Question 17 months ago, created a question with more than 1,000 views. For HTseq Pysam error
Popular Question 17 months ago, created a question with more than 1,000 views. For Trimmomatic jar file
Popular Question 17 months ago, created a question with more than 1,000 views. For Interpretation of Results from trimmomatic
Popular Question 17 months ago, created a question with more than 1,000 views. For HTseq error: Too few arguements
Popular Question 17 months ago, created a question with more than 1,000 views. For DESeq2 workflow for RNAseq
Popular Question 17 months ago, created a question with more than 1,000 views. For Feature Counts output interpretation
Popular Question 20 months ago, created a question with more than 1,000 views. For Unable to access jarfile trimmomatic-0.35
Rising Star 2.1 years ago, created 50 posts within first three months of joining.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1414 users visited in the last hour