User: xupbuy

gravatar for xupbuy
xupbuy0
Reputation:
0
Status:
New User
Last seen:
1 month, 2 weeks ago
Joined:
1 year, 4 months ago
Email:
x*****@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by xupbuy

<prev • 14 results • page 1 of 2 • next >
0
votes
1
answer
140
views
1
answers
Comment: C: How to make plots with gene clusters based on the gene length and orientation?
... Thanks a lot! I'll need to try a bunch of different tools in your post. ...
written 10 weeks ago by xupbuy0
0
votes
1
answer
140
views
1
answer
How to make plots with gene clusters based on the gene length and orientation?
... I have >30 gene clusters in fasta files downloaded from NCBI. I want to make plots like this: ![enter image description here][1] [1]: https://i.postimg.cc/zf9N0p9C/Screen-Shot-2018-11-05-at-10-23-48-AM.png How to make this kind of plots for all my gene clusters with different gene lengths an ...
gene cluster plot written 10 weeks ago by xupbuy0 • updated 10 weeks ago by jrj.healey9.8k
0
votes
0
answers
123
views
0
answers
Comment: C: sort dictionary in python?
... sorry. I'll try stackoverflow. ...
written 10 weeks ago by xupbuy0
0
votes
0
answers
123
views
0
answers
Comment: C: sort dictionary in python?
... Thank you for the reply. ...
written 10 weeks ago by xupbuy0
0
votes
0
answers
123
views
0
answers
(Closed) sort dictionary in python?
... I have a dictionary: d = {'b':1, 'a':3, 'aa':12,'c':24, 'bb':31,'abc':123} I have a list containing keys: l = ['a','c','b','abc','bb','aa'] How to sort d1 based on l in python (or pandas)? I want the keys in d1 to be sorted in the order in l. d_sorted = {'a':3,'c':24, 'b':1,'abc':12 ...
python written 11 weeks ago by xupbuy0
0
votes
2
answers
279
views
2
answers
Comment: C: Extract a subset of fasta file based on header in python
... Indeed! Thank you finally! Worked! ...
written 3 months ago by xupbuy0
2
votes
2
answers
279
views
6 follow
2
answers
Extract a subset of fasta file based on header in python
... I have a fasta file like this: >Contig1 aattata >Contig2 ttgtgtgt >Contig3 cgcgtgtgt >Contig4 tgtgttgtttttt >Contig5 cccgcgctg >Contig6 tgtgtgtgtgtgt >Contig7 aacgctg >Contig8 acgtgtgc I have a 2nd txt file: ...
fasta python written 3 months ago by xupbuy0 • updated 3 months ago by Siya Diya0
0
votes
0
answers
262
views
0
answers
Comment: C: How to identify contigs containing the degenerate primer sequences using python?
... Thank you. What if I want to add the mismatch function? For example, '-mismatch 2' means it can tolerate 2 mismatches, continuous mismatch or non-continuous match. Thank you very much. ...
written 4 months ago by xupbuy0
0
votes
0
answers
262
views
0
answers
How to identify contigs containing the degenerate primer sequences using python?
... I have a txt file with DNA sequences, each DNA sequence starting with ">Contig..." is called a contig. The file looks like this: >Contig4679 CGGCGACGCCGGTGAGCCCACCGTTCCAGCGCAATGACAACAGCTGTAGCCCGCCCGAGA GCGCCGTGAGGAACACGGCGGCGGGCACGAGGATGATGCGGCGGCCCACGGTCATGAGCA CGATGGATGCGAAC ...
assembly sequence python written 4 months ago by xupbuy0 • updated 3 months ago by gb570
0
votes
0
answers
675
views
0
answers
samtools vs bedtools
... Hi I have a silly question: What is the difference between samtools depth and bedtools genomecov? For both tools, the input file needs to be ***.sorted.bam, which was generated by sam->bam->sorted.bam. I tried both tools using the same *.sorted.bam input file and they generate the same covera ...
alignment sequencing written 13 months ago by xupbuy0 • updated 13 months ago by genomax60k

Latest awards to xupbuy

Popular Question 13 months ago, created a question with more than 1,000 views. For How to map contigs to the reference genome and know the start and end position?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 743 users visited in the last hour