User: xupbuy

gravatar for xupbuy
xupbuy0
Reputation:
0
Status:
New User
Last seen:
5 hours ago
Joined:
1 year, 2 months ago
Email:
x*****@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by xupbuy

<prev • 14 results • page 1 of 2 • next >
0
votes
1
answer
103
views
1
answers
Comment: C: How to make plots with gene clusters based on the gene length and orientation?
... Thanks a lot! I'll need to try a bunch of different tools in your post. ...
written 11 days ago by xupbuy0
0
votes
1
answer
103
views
1
answer
How to make plots with gene clusters based on the gene length and orientation?
... I have >30 gene clusters in fasta files downloaded from NCBI. I want to make plots like this: ![enter image description here][1] [1]: https://i.postimg.cc/zf9N0p9C/Screen-Shot-2018-11-05-at-10-23-48-AM.png How to make this kind of plots for all my gene clusters with different gene lengths an ...
gene cluster plot written 11 days ago by xupbuy0 • updated 11 days ago by jrj.healey8.6k
0
votes
0
answers
97
views
0
answers
Comment: C: sort dictionary in python?
... sorry. I'll try stackoverflow. ...
written 11 days ago by xupbuy0
0
votes
0
answers
97
views
0
answers
Comment: C: sort dictionary in python?
... Thank you for the reply. ...
written 11 days ago by xupbuy0
0
votes
0
answers
97
views
0
answers
(Closed) sort dictionary in python?
... I have a dictionary: d = {'b':1, 'a':3, 'aa':12,'c':24, 'bb':31,'abc':123} I have a list containing keys: l = ['a','c','b','abc','bb','aa'] How to sort d1 based on l in python (or pandas)? I want the keys in d1 to be sorted in the order in l. d_sorted = {'a':3,'c':24, 'b':1,'abc':12 ...
python written 13 days ago by xupbuy0
0
votes
2
answers
195
views
2
answers
Comment: C: Extract a subset of fasta file based on header in python
... Indeed! Thank you finally! Worked! ...
written 6 weeks ago by xupbuy0
2
votes
2
answers
195
views
6 follow
2
answers
Extract a subset of fasta file based on header in python
... I have a fasta file like this: >Contig1 aattata >Contig2 ttgtgtgt >Contig3 cgcgtgtgt >Contig4 tgtgttgtttttt >Contig5 cccgcgctg >Contig6 tgtgtgtgtgtgt >Contig7 aacgctg >Contig8 acgtgtgc I have a 2nd txt file: ...
fasta python written 6 weeks ago by xupbuy0 • updated 6 weeks ago by Siya Diya0
0
votes
0
answers
204
views
0
answers
Comment: C: How to identify contigs containing the degenerate primer sequences using python?
... Thank you. What if I want to add the mismatch function? For example, '-mismatch 2' means it can tolerate 2 mismatches, continuous mismatch or non-continuous match. Thank you very much. ...
written 9 weeks ago by xupbuy0
0
votes
0
answers
204
views
0
answers
How to identify contigs containing the degenerate primer sequences using python?
... I have a txt file with DNA sequences, each DNA sequence starting with ">Contig..." is called a contig. The file looks like this: >Contig4679 CGGCGACGCCGGTGAGCCCACCGTTCCAGCGCAATGACAACAGCTGTAGCCCGCCCGAGA GCGCCGTGAGGAACACGGCGGCGGGCACGAGGATGATGCGGCGGCCCACGGTCATGAGCA CGATGGATGCGAAC ...
assembly sequence python written 9 weeks ago by xupbuy0 • updated 5 weeks ago by gb460
0
votes
0
answers
594
views
0
answers
samtools vs bedtools
... Hi I have a silly question: What is the difference between samtools depth and bedtools genomecov? For both tools, the input file needs to be ***.sorted.bam, which was generated by sam->bam->sorted.bam. I tried both tools using the same *.sorted.bam input file and they generate the same covera ...
alignment sequencing written 11 months ago by xupbuy0 • updated 11 months ago by genomax58k

Latest awards to xupbuy

Popular Question 11 months ago, created a question with more than 1,000 views. For How to map contigs to the reference genome and know the start and end position?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 890 users visited in the last hour