User: xupbuy

gravatar for xupbuy
xupbuy0
Reputation:
0
Status:
New User
Last seen:
6 days, 2 hours ago
Joined:
1 year ago
Email:
x*****@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by xupbuy

<prev • 7 results • page 1 of 1 • next >
0
votes
0
answers
103
views
0
answers
Comment: C: How to identify contigs containing the degenerate primer sequences using python?
... Thank you. What if I want to add the mismatch function? For example, '-mismatch 2' means it can tolerate 2 mismatches, continuous mismatch or non-continuous match. Thank you very much. ...
written 10 days ago by xupbuy0
0
votes
0
answers
103
views
0
answers
How to identify contigs containing the degenerate primer sequences using python?
... I have a txt file with DNA sequences, each DNA sequence starting with ">Contig..." is called a contig. The file looks like this: >Contig4679 CGGCGACGCCGGTGAGCCCACCGTTCCAGCGCAATGACAACAGCTGTAGCCCGCCCGAGA GCGCCGTGAGGAACACGGCGGCGGGCACGAGGATGATGCGGCGGCCCACGGTCATGAGCA CGATGGATGCGAAC ...
assembly sequence python written 10 days ago by xupbuy0 • updated 10 days ago by shenwei3564.1k
0
votes
0
answers
515
views
0
answers
samtools vs bedtools
... Hi I have a silly question: What is the difference between samtools depth and bedtools genomecov? For both tools, the input file needs to be ***.sorted.bam, which was generated by sam->bam->sorted.bam. I tried both tools using the same *.sorted.bam input file and they generate the same covera ...
alignment sequencing written 9 months ago by xupbuy0 • updated 9 months ago by genomax56k
0
votes
1
answer
1.2k
views
1
answers
Comment: C: How to map contigs to the reference genome and know the start and end position?
... Thank you. minimap2 is like Bowtie, for reads mapping to reference. I want to map contigs to reference and make a plot like [this:][1] [1]: https://ibb.co/mnqkcb ...
written 10 months ago by xupbuy0
0
votes
1
answer
1.2k
views
1
answers
Comment: C: How to map contigs to the reference genome and know the start and end position?
... Thank you very much for your reply. After I run Blast, is there a way to make a plot? like this: [contig mapping to reference plot][1] [1]: https://ibb.co/mnqkcb ...
written 10 months ago by xupbuy0
4
votes
1
answer
1.2k
views
1
answer
How to map contigs to the reference genome and know the start and end position?
... Hi experts, I want to map my assembled contigs to the reference genome and want to know where every mapped contig starts and ends on the reference genome. And after that, I want to plot it to see where on the genome have more contigs so that I can know the enrichment region. Is there a way to do t ...
genome alignment sequencing written 11 months ago by xupbuy0
0
votes
0
answers
372
views
0
answers
How to add annotation to a list of Genbank IDs (obtained from BLAST)?
... Hi, I used DIAMOND -BLASTX to Blast my Miseq reads against the NCBI protein database and got a list of Genbank IDs, like this: ID reads 0 KKP65897.1 63724 1 KKP42119.1 61534 2 KKP91065.1 60092 3 OGY93232.1 56218 4 KUK66913.1 51494 How to annotate those IDs? I want to know what pr ...
annotation alignment blast sequencing written 12 months ago by xupbuy0

Latest awards to xupbuy

Popular Question 9 months ago, created a question with more than 1,000 views. For How to map contigs to the reference genome and know the start and end position?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1004 users visited in the last hour