User: qudrat

gravatar for qudrat
qudrat30
Reputation:
30
Status:
New User
Location:
NATIONAL INSTITUTE OF IMMUNOLOGY, INDIA
Last seen:
1 week, 2 days ago
Joined:
2 months, 4 weeks ago
Email:
q*****@nii.ac.in

Can somebody tell me how mask gtf file is generated?

Posts by qudrat

<prev • 58 results • page 1 of 6 • next >
0
votes
1
answer
127
views
1
answer
cuffcompare and cufflinks
... Hello everyone, What is difference between Cuffcompare class code "=" or "c" ? Please help me as it has been hampering my work Thank you ...
assembly rna-seq written 10 days ago by qudrat30 • updated 10 days ago by Vijay Lakhujani1.5k
2
votes
1
answer
185
views
1
answer
gene expression and RNA-Seq
... Hello All, I want to know through RNA-Seq analysis whether a particular transcript is getting expressed in a tissue or not. Please suggest me how to proceed. ...
gene rna-seq written 4 weeks ago by qudrat30 • updated 4 weeks ago by Devon Ryan74k
0
votes
1
answer
199
views
1
answers
Comment: A: fasta redundant sequence
... >uc001aal.1 CDS=1-916 ATGGTGACTGAATTCATTTTTCTGGGTCTCTCTGATTCTCAGGAACTCCAGACCTTCCTATTTATGTTGTTTTTTGTATTCTATGGAGGAATCGTGTTTGGAAACCTTCTTATTGTCATAACAGTGGTATCTGACTCCCAC >uc001aak.4 CACACAACGGGGTTTCGGGGCTGTGGACCCTGTGCCAGGAAAGGAAGGGCGCAGCTCCTGCAATGCGGAGCAGCCAGGGCAGTGGGCACCAGGCTTTAGCCT ...
written 5 weeks ago by qudrat30 • updated 5 weeks ago by Pierre Lindenbaum102k
3
votes
1
answer
199
views
5 follow
1
answer
fasta redundant sequence
... Hello all, I have downloaded GENCODE and RefSeq transcripts and I want to combine these and filter for redundancy. Please suggest me how to proceed. Thank you ...
redundant sequence removal written 5 weeks ago by qudrat30 • updated 5 weeks ago by cpad01123.8k
1
vote
0
answers
127
views
0
answers
(Closed) computer program gcc
... Hello all, I have GCC installed in my computer and I am still unable to run a simple C program. please help me ...
computer programming and gcc written 5 weeks ago by qudrat30
1
vote
0
answers
266
views
0
answers
Comment: C: Cufflinks analysis and gffread
... Thank you very much Kevin! ...
written 6 weeks ago by qudrat30
0
votes
0
answers
266
views
0
answers
Comment: C: Cufflinks analysis and gffread
... Is there any way to extract sequence of just one transcript, like above aformentioned transcript? ...
written 6 weeks ago by qudrat30
0
votes
0
answers
266
views
0
answers
Comment: C: Cufflinks analysis and gffread
... It is correctly formatted but I really do not understand why only few of such transcripts giving only sequence of one exon. ...
written 6 weeks ago by qudrat30
0
votes
0
answers
266
views
0
answers
Comment: C: Cufflinks analysis and gffread
... Hi Kevin, chr1 StringTie transcript 533488 630489 0 - 0 transcript_id "TCONS_00012328" gene_id "XLOC_002003" oId "STRG.11.1" tss_id "TSS6802" chr1 StringTie exon 533488 533516 0 - 0 transcript_id "TCONS_00012328" gene_id "XLOC_002003" exon_number "1" chr1 StringTie exon 591734 591751 0 - 0 ...
written 6 weeks ago by qudrat30 • updated 6 weeks ago by Kevin Blighe9.3k
0
votes
0
answers
266
views
0
answers
Comment: C: Cufflinks analysis and gffread
... Hi Kevin, Actually this is not a single exon transcript, it has three exon but when I use gffread to get fasta sequence it gives the sequence of only third exon. There are few more such transcripts. ...
written 6 weeks ago by qudrat30

Latest awards to qudrat

Supporter 5 weeks ago, voted at least 25 times.
Rising Star 6 weeks ago, created 50 posts within first three months of joining.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1391 users visited in the last hour