User: makwana.kd

gravatar for makwana.kd
makwana.kd10
Reputation:
10
Status:
New User
Location:
Last seen:
1 month ago
Joined:
1 year, 7 months ago
Email:
m*********@gmail.com

Posts by makwana.kd

<prev • 12 results • page 1 of 2 • next >
0
votes
1
answer
98
views
1
answers
Comment: C: Empty BAM file upon mapping with STAR
... Thank you so much Manuel. It was such a silly mistake and now I feel stupid. Your time and help is much appreciated. ...
written 4 weeks ago by makwana.kd10
3
votes
1
answer
98
views
1
answer
Empty BAM file upon mapping with STAR
... I am using to align RNA sequence reads to the reference genome I created using STAR. I have done the QC of every fastq file before running the mapping job. The problem I am encountering is that some of the fastq files are generating empty BAM files, whereas, other files have no problem. I am hereby ...
rna-seq written 4 weeks ago by makwana.kd10 • updated 4 weeks ago by manuel.belmadani840
0
votes
1
answer
213
views
1
answers
Comment: C: Interpreting HTSeq output file
... That was a different BAM file which was giving me an error, so I converted it to SAM file and I ran through HTSeq, that file gave me the following output: chr1 3206084 255 1S139M = 3206084 -139 NTACAGTTAACCAACTTATACAGTTAACCAACTCCTACACTAGGTTCCTGAGCATTTCCTTAAACTTGCTAGTTCTGGTTTCCTGGCATGTGAGAGTAAGTCACA ...
written 12 weeks ago by makwana.kd10
0
votes
1
answer
213
views
1
answers
Comment: C: Interpreting HTSeq output file
... Sorry, there was a misspelling in the above-mentioned command. This is the corrected one: htseq-count -m union -f bam -s no -r name ALZT22-2Cunsorted.bam geneassembly.gff3 -o countread.text Yes, the head command output was for countread.text krishna@dntdaretouchit:/mnt/e/cannon$ head countread.te ...
written 12 weeks ago by makwana.kd10
0
votes
1
answer
213
views
1
answers
Comment: C: Interpreting HTSeq output file
... Hi Lieven, Following is the command i used : htseq-count -m union -f bam -s no -r name ALZT22-2Cunsorted.bam geneassembly.gff3 -o counread.text The bam file is name sorted head command gives me the following output: XF:Z:__ambiguous[ENSMUSG00000098178.1+ENSMUSG00000106106.2] XF:Z:__ambi ...
written 12 weeks ago by makwana.kd10
1
vote
1
answer
213
views
1
answer
Interpreting HTSeq output file
... I have an output file (text format) which I exported into excel spreadsheet. I see three columns, but I do not see the numeric value for the counts. Is this normal? Column1 Column2 Column3 " XF" Z __ambiguous[ENSMUSG00000098178.1+ENSMUSG00000106106.2] " XF" Z __ambig ...
rna-seq written 12 weeks ago by makwana.kd10 • updated 12 weeks ago by brianj.park0
0
votes
0
answers
74
views
0
answers
Comment: C: HTSeq error while counting reads
... Hello Lieven.streck, Thanks for replying. I found that something was not right on the BAM while, so what I did was convert BAM into SAM file and then it through HTSeq, and it worked. ...
written 12 weeks ago by makwana.kd10
1
vote
2
answers
228
views
2
answers
Comment: C: Problem installing HTSeq on Windows 10
... Thank you ATpoint, I have installed it on Ubuntu. ...
written 12 weeks ago by makwana.kd10
0
votes
2
answers
228
views
2
answers
Comment: C: Problem installing HTSeq on Windows 10
... Thank you Jared, Yes I missed that. I instead have installed it on Ubuntu. However, I am getting an error while running it on BAM file. Error occured when reading beginning of SAM/BAM file. unsigned byte integer is greater than maximum Exception type: OverflowError, raised in libcutils.pyx:50 ...
written 12 weeks ago by makwana.kd10
4
votes
2
answers
228
views
2
answers
Problem installing HTSeq on Windows 10
... Hi Everybody, I am trying to install HTSeq on windows 10 64bit machine. I have tried using python command "pip install HTSeq", to get the following error: C:\Python27\Scripts>pip install htseq DEPRECATION: Python 2.7 will reach the end of its life on January 1st, 2020. Please upgrade y ...
software error written 12 weeks ago by makwana.kd10 • updated 12 weeks ago by jared.andrews072.5k

Latest awards to makwana.kd

Popular Question 14 months ago, created a question with more than 1,000 views. For Sequence duplication levels-RNA Seq

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 642 users visited in the last hour