User: makwana.kd

gravatar for makwana.kd
makwana.kd20
Reputation:
20
Status:
New User
Location:
Last seen:
4 weeks ago
Joined:
2 years, 7 months ago
Email:
m*********@gmail.com

Posts by makwana.kd

<prev • 15 results • page 1 of 2 • next >
0
votes
1
answer
68
views
1
answer
Merging HTseq files
... Hi, I have been trying to merge HTseq files into one data matrix using following script. However, I am encountering following error; directory <- "C/RNA SEQ adv cgrp/IWAT" sampleFiles <- grep("COUNT FILES",list.files(directory),value=TRUE) condition <- c('237 COUNT F ...
R rna-seq written 28 days ago by makwana.kd20 • updated 28 days ago by Kevin Blighe60k
0
votes
2
answers
4.0k
views
2
answers
Comment: C: How to input data for DESeq2 from individual HTSeq count?
... Hi ZZzzzzhong I am trying to follow the method you have suggested, however, I am getting an error " Error in data.frame(sampleName = sampleFiles, fileName = sampleFiles, : arguments imply differing number of rows: 0, 4". I have checked the number of rows in all individual files , and they are sa ...
written 28 days ago by makwana.kd20
1
vote
0
answers
109
views
0
answers
Error running htseq count files in deseq2
... Hello , I am running differential expression analysis using deseq2 in galaxy. I have been encountering below mentioned error again and again. I have tried looking for any duplicate rows in my file but found none. Any help is much appreciated. Error in data.frame(sample = basename(filenamesIn), fi ...
software error rna-seq written 3 months ago by makwana.kd20
0
votes
1
answer
554
views
1
answers
Comment: C: Empty BAM file upon mapping with STAR
... Thank you so much Manuel. It was such a silly mistake and now I feel stupid. Your time and help is much appreciated. ...
written 12 months ago by makwana.kd20
3
votes
1
answer
554
views
1
answer
Empty BAM file upon mapping with STAR
... I am using to align RNA sequence reads to the reference genome I created using STAR. I have done the QC of every fastq file before running the mapping job. The problem I am encountering is that some of the fastq files are generating empty BAM files, whereas, other files have no problem. I am hereby ...
rna-seq written 12 months ago by makwana.kd20 • updated 12 months ago by manuel.belmadani1.2k
0
votes
1
answer
685
views
1
answers
Comment: C: Interpreting HTSeq output file
... That was a different BAM file which was giving me an error, so I converted it to SAM file and I ran through HTSeq, that file gave me the following output: chr1 3206084 255 1S139M = 3206084 -139 NTACAGTTAACCAACTTATACAGTTAACCAACTCCTACACTAGGTTCCTGAGCATTTCCTTAAACTTGCTAGTTCTGGTTTCCTGGCATGTGAGAGTAAGTCACA ...
written 14 months ago by makwana.kd20
0
votes
1
answer
685
views
1
answers
Comment: C: Interpreting HTSeq output file
... Sorry, there was a misspelling in the above-mentioned command. This is the corrected one: htseq-count -m union -f bam -s no -r name ALZT22-2Cunsorted.bam geneassembly.gff3 -o countread.text Yes, the head command output was for countread.text krishna@dntdaretouchit:/mnt/e/cannon$ head countread.te ...
written 14 months ago by makwana.kd20
0
votes
1
answer
685
views
1
answers
Comment: C: Interpreting HTSeq output file
... Hi Lieven, Following is the command i used : htseq-count -m union -f bam -s no -r name ALZT22-2Cunsorted.bam geneassembly.gff3 -o counread.text The bam file is name sorted head command gives me the following output: XF:Z:__ambiguous[ENSMUSG00000098178.1+ENSMUSG00000106106.2] XF:Z:__ambi ...
written 14 months ago by makwana.kd20
1
vote
1
answer
685
views
1
answer
Interpreting HTSeq output file
... I have an output file (text format) which I exported into excel spreadsheet. I see three columns, but I do not see the numeric value for the counts. Is this normal? Column1 Column2 Column3 " XF" Z __ambiguous[ENSMUSG00000098178.1+ENSMUSG00000106106.2] " XF" Z __ambig ...
rna-seq written 14 months ago by makwana.kd20 • updated 14 months ago by brianj.park20
0
votes
0
answers
74
views
0
answers
Comment: C: HTSeq error while counting reads
... Hello Lieven.streck, Thanks for replying. I found that something was not right on the BAM while, so what I did was convert BAM into SAM file and then it through HTSeq, and it worked. ...
written 14 months ago by makwana.kd20

Latest awards to makwana.kd

Popular Question 2.2 years ago, created a question with more than 1,000 views. For Sequence duplication levels-RNA Seq

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1615 users visited in the last hour