User: bioplanet

gravatar for bioplanet
bioplanet40
Reputation:
40
Status:
New User
Location:
Last seen:
3 months, 2 weeks ago
Joined:
7 months, 4 weeks ago
Email:
k**************@gmail.com

Posts by bioplanet

<prev • 39 results • page 1 of 4 • next >
0
votes
1
answer
503
views
1
answers
Comment: C: SAM file CIGAR string clarification
... Many thanks for your help! ...
written 6 months ago by bioplanet40
0
votes
1
answer
503
views
1
answers
Comment: C: SAM file CIGAR string clarification
... Ok then I only extract I, S and H as you initially wrote, then, in this example the alignment was 35bases at some point and then 9 more after 1349 bases that are omitted. But then is it correct for me to say that the alignment start e.g. at position 7751 and finishes at position 7751 + 35 + 1349 +9? ...
written 6 months ago by bioplanet40
0
votes
1
answer
503
views
1
answers
Comment: C: SAM file CIGAR string clarification
... So it is 35 + 9, the 1349 is ignored, right? Or? ...
written 6 months ago by bioplanet40
0
votes
1
answer
503
views
1
answers
Comment: C: SAM file CIGAR string clarification
... Many thanks Devon (yes I meant to write column 4 :) ) I also saw this one: 35M1349N9M and the read is GATAGCATTGGGAGATATACCTAATGCTAGATGACAACAGGAAC so here the total length is 35+9 or 35+1349+9? I am bit confused.. ...
written 6 months ago by bioplanet40
5
votes
1
answer
503
views
1
answer
SAM file CIGAR string clarification
... Hello all, I just wanted to verify that I got it correct: In an sequencing experiment, when I have the SAM file, I get these kind of lines: read1 16 reference 7695 255 36M15D69M * 0 0 GATAGCATTGGGAGATATACCTAATGCTAGATGACGGGGTGAACATTAGTGGGTGCAGCGCACAAGCAT ...
rna-seq written 6 months ago by bioplanet40 • updated 6 months ago by Devon Ryan80k
0
votes
0
answers
396
views
0
answers
Comment: C: bbmerge not joining paired-end reads
... Hello everyone! So, I also checked FLASH and still I cannot get overlap; so I am guessing it was not a problem of BBmerge, rather there is some problem with the data itself. I will treat them seperately for time being and maybe the next round of experiments will be more informative. Many thanks to ...
written 6 months ago by bioplanet40
1
vote
0
answers
396
views
0
answers
Comment: C: bbmerge not joining paired-end reads
... Many thanks to all of you! I will try leeHom and maybe FLASH (just saw this) and see how it looks, will post again! ...
written 6 months ago by bioplanet40
0
votes
0
answers
396
views
0
answers
Comment: C: bbmerge not joining paired-end reads
... So is this then a software problem? Because it seemed it was working so nicely in the first round of experiments (where I could merge 98% or so of them), so I did not give it too much thought... Is leeHom better then? (I mean, of course for a newly introduced person to genomics like me, I can't real ...
written 6 months ago by bioplanet40
0
votes
0
answers
396
views
0
answers
Comment: C: bbmerge not joining paired-end reads
... Amplicon-seq data, it is the same construct being used (~430 nts long). Another example: @M00316:13:000000000-BDR9L:1:1101:22760:19050 1:N:0:CATGCTTA AACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCGATAAACAAGTTTAGTTACGCTAGTTTCGCGTACGAAGCCCTGCAGGCTACTTGGCGT ...
written 6 months ago by bioplanet40
0
votes
0
answers
396
views
0
answers
Comment: C: bbmerge not joining paired-end reads
... Thanks genomax (also upvoted some previous posts). The thing is that even if I try to merge before trimming, they still remain "ambiguous" and discarded. As far as I can tell (don't know if this is correct), merging is basically done by comparing the quality strings on each pair. For example, the p ...
written 6 months ago by bioplanet40

Latest awards to bioplanet

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1551 users visited in the last hour