User: bioplanet

gravatar for bioplanet
bioplanet10
Reputation:
10
Status:
New User
Location:
Last seen:
19 minutes ago
Joined:
3 weeks, 5 days ago
Email:
k**************@gmail.com

Posts by bioplanet

<prev • 25 results • page 1 of 3 • next >
1
vote
0
answers
34
views
0
answers
Error rate of Illumina MiSeq
... Hi all, I wanted to know if there is a study/paper where I can see the Illumina error rate for Miseq data. I ran across this older post: https://www.biostars.org/p/198023/ and this paper: http://onlinelibrary.wiley.com/doi/10.1111/j.1755-0998.2011.03024.x/full from 2011, where it says that the ...
sequencing written 38 minutes ago by bioplanet10
0
votes
4
answers
107
views
4
answers
Answer: A: Fasta header trimming for multiple delimiters
... Also in perl (if you want): perl -e 'while(<>) {if($_=~/^.*?\|(.*?)\|/) {$id=$1; print ">$id\n";}}' ...
written 23 hours ago by bioplanet10 • updated 22 hours ago by genomax37k
0
votes
0
answers
62
views
0
answers
Strange length of merged paired-end sequencing reads after using BBmerge
... Hi all, I encountered a strange problem when using BBmerge to align paired-end sequencing data. My construct that got amplified is 430nts long and each read is of 250nts long. However, out of the 2,2M reads, I get some strange lengths for the merged pairs). As you will see in the list below (where ...
bbmerge paired-end alignment written 23 hours ago by bioplanet10
0
votes
0
answers
93
views
0
answers
Comment: C: Simulate long deletions in alignment
... Ok, I will try to explain it a bit better: My amplicon-seq is basically a construct of ~450nts which is sequenced using paired-end sequencing (each read has 250nts). This construct can be (potentially) modified by Cas9 in a CrispR-Cas experiment, say Cas9 could cut 5 or 10 nts somewhere but my rea ...
written 5 days ago by bioplanet10
2
votes
0
answers
93
views
0
answers
Simulate long deletions in alignment
... Hi! I am working with STAR aligner and I wanted to ask how it treats large deletions. For example, in the read below: @read_ID GACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAATGAATTAATTAAGAATGAGGTTTGCAGGAGCGGATTGCTTCGAACCGCTAAAATTTATTGTCCT ...
alignment written 6 days ago by bioplanet10
0
votes
0
answers
91
views
0
answers
(Closed) Question on SAMTOOLS MPILEUP output
... Hi, I am using SAMTOOLS MPILEUP and I have trouble understanding the output. What I know is: -> output 1. Sequence name 2. 1-based coordinate 3. Reference base 4. Number of reads covering this position 5. Read bases 6. Base qualities 7. Alignment ...
samtools mpileup written 13 days ago by bioplanet10
0
votes
0
answers
140
views
0
answers
Comment: C: Paired-end amplicon sequencing data
... Thank you! I was not aware of bbmerge, I will give it a try ASAP! ...
written 15 days ago by bioplanet10
0
votes
0
answers
140
views
0
answers
Comment: C: Paired-end amplicon sequencing data
... Hi to both and thanks for answering! Basically, what I want your opinion about is the following scenario: >read_ID ACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCG.GGGCCGCCACTCCACCGGCGGCTTGGACGCGCTGAACAAGGAATGAATTTATTAAGAATGAGGTTTGCAGGAGCGGATTGCTTCGAACCGCTTGACTTGATTGTCCTCCGCGAATTA ...
written 15 days ago by bioplanet10
0
votes
0
answers
140
views
0
answers
Paired-end amplicon sequencing data
... Hi all, this question is addressed to those of you that have worked with paired-end amplicon sequencing data from Illumina. So, what I have is a construct of say 400bp that has been sequencing from both sides, with reads of 250 bp each. My question is, when I analyze the data I get, do I regard eac ...
paired-end sequencing written 15 days ago by bioplanet10
0
votes
1
answer
143
views
1
answers
Comment: C: Processing barcoded sequencing data
... Hello and thank you very much for your answers. My barcodes are random 8mers that I do not know beforehand. They are tagged to each sequence that is ordered and gets amplified (I am sorry if I am not explaining it perfectly, I am new to this). They key thing is that nobody knows these 8mers beforeh ...
written 18 days ago by bioplanet10

Latest awards to bioplanet

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1659 users visited in the last hour