User: ramiroricardo

Reputation:
0
Status:
New User
Last seen:
1 week, 1 day ago
Joined:
2 years, 4 months ago
Email:
r************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by ramiroricardo

<prev • 4 results • page 1 of 1 • next >
0
votes
0
answers
67
views
0
answers
Adding features to genbank file based on feature table
... I am trying to annotate a genome for which I have a close reference. I have done annotation using DFAST and ended up with a genbank file like the one below. As you will see the first CDS has been annotated as a "hypothetical protein" and lacks a /gene name, whereas the second CDS has been annotated ...
genome annotation genbank written 12 days ago by ramiroricardo0
0
votes
1
answer
151
views
1
answers
Comment: A: Creating assembly graphs .gfa
... I have the same question. It would be great to get some tips on how to do this. ...
written 6 weeks ago by ramiroricardo0
3
votes
0
answers
1.7k
views
0
answers
Error reading gff file into R (with read.gff from the ape package)
... Dear all, I was trying to read a gff3 genome file into R, but I get the following error: Error in scan(file, w, sep = "\t", quote = "", quiet = TRUE, na.strings = na.strings, : scan() expected 'an integer', got 'TCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTAC' Has anyone ...
genome R gff written 2.4 years ago by ramiroricardo0 • updated 2.4 years ago by WouterDeCoster43k
0
votes
0
answers
620
views
0
answers
tool for simulating genomes based on observed mutations?
... I have sequenced a set of bacterial clones, derived from the same reference strain, and identified a few thousand mutations. Sometimes I have more than one mutation in the same gene and I would like to know whether those cases are expected or not, given a random distribution of mutations. I was t ...
whole-genome sequencing simulation written 2.4 years ago by ramiroricardo0

Latest awards to ramiroricardo

Popular Question 12 months ago, created a question with more than 1,000 views. For Error reading gff file into R (with read.gff from the ape package)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1268 users visited in the last hour