User: jaqx008

gravatar for jaqx008
jaqx00830
Reputation:
30
Status:
New User
Location:
Last seen:
20 hours ago
Joined:
7 months, 3 weeks ago
Email:
j******@gmail.com

Posts by jaqx008

<prev • 132 results • page 1 of 14 • next >
0
votes
0
answers
99
views
0
answers
Comment: C: Needing help with a Count table Graph
... Thanks. My organism (lancelet) does not have a well anotated genome. I did blast the 21nt sequence and got a protein that I assume should correspond to were the siRNA regulate. I used this protein to blast a related specie (Homo sapien or mouse). and got BCAT_beta_family cd01557 BCAT_beta ...
written 2 days ago by jaqx00830
0
votes
0
answers
99
views
0
answers
Needing help with a Count table Graph
... Hello Guys, This is not much of a computation question. I made this count table bar graphs for siRNA I have from RNAseq data of a female organism. overral, the siRNA was low for all BUT ONE loci. Im trying to identify the mRNA regulated by this one siRNA (ACCCATAGATCCGAGCTTGTG) but dont know how to ...
sirna mapping counttable loci id written 3 days ago by jaqx00830
0
votes
4
answers
291
views
4
answers
Answer: A: GREP: out of memory
... I was able to resolve this issue. If anyone else runs into the same problem, the command bellow should help. first split files into few lines using split -l n file.txt where n= number of lines desired (I did n = 5) $ for i in x*; do grep -f "$i" file2.gff > "$i".tmp.gff; done &&am ...
written 9 days ago by jaqx00830 • updated 9 days ago by genomax51k
0
votes
4
answers
291
views
4
answers
Comment: C: GREP: out of memory
... Yes I am trying to pull out certain genes IDs with there corresponding information. I posted in the comment above what my files look like. the thing is, it works fine for some and does not for others. ...
written 13 days ago by jaqx00830
0
votes
4
answers
291
views
4
answers
Comment: C: GREP: out of memory
... Hey, Where in the command would you put -m? I mean where in while read line; do grep -wF "$line" 2.gff; done < 1.txt ...
written 13 days ago by jaqx00830
0
votes
4
answers
291
views
4
answers
Comment: C: GREP: out of memory
... OK. the text files rang between 100bytes to about 50kb with word count around 1500 and in this format 2597857964 2597857966 2597857965 2597857963 2597860200 2597857153 2597857472 while the .gff range from about 600kb to about 900kb with wc of about 5000 to 7000 in the f ...
written 13 days ago by jaqx00830
0
votes
4
answers
291
views
4
answers
Comment: C: GREP: out of memory
... This is what I am trying to do. there are some gene IDs in a text file A, and lines possibly containing the gene IDs in gff file B. I am trying to identify the matches in B and outpur all the lines that match in B ( this should output all the columns in B. A has only one column of gene IDs B has has ...
written 13 days ago by jaqx00830
0
votes
4
answers
291
views
4
answers
Comment: C: GREP: out of memory
... well I cant post more than 5 times in 6 hours and thats why I havent responded. BTW I am grep-ing a text file like 2345 3245 5432 1234 against a .gff file like 4634 - ID=2345 4353 + ID=3245 etc its working for some and giving memory complain for others. ...
written 13 days ago by jaqx00830
0
votes
4
answers
291
views
4
answers
Comment: C: GREP: out of memory
... I did this and it worked for one of the txt already but one gave this error. does it mean no match? grep: empty (sub)expression ...
written 14 days ago by jaqx00830
0
votes
4
answers
291
views
4
answers
Comment: C: GREP: out of memory
... It gives a long list that looks like this then terminates aftyer I run the command grep: illegal byte sequence grep: illegal byte sequence grep: illegal byte sequence grep: illegal byte sequence grep: output.txt: No such file or directory grep: illegal byte sequence grep ...
written 14 days ago by jaqx00830

Latest awards to jaqx008

Scholar 9 days ago, created an answer that has been accepted. For A: GREP: out of memory
Centurion 11 weeks ago, created 100 posts.
Rising Star 4 months ago, created 50 posts within first three months of joining.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1522 users visited in the last hour