User: jack1120

gravatar for jack1120
jack112030
Reputation:
30
Status:
New User
Location:
University of Minnesota
Twitter:
@LWJacksonIII
Last seen:
1 year, 5 months ago
Joined:
1 year, 8 months ago
Email:
j*******@umn.edu

Posts by jack1120

<prev • 6 results • page 1 of 1 • next >
0
votes
0
answers
1.0k
views
0
answers
Comment: C: Relabel/rename OTU IDs in an OTU table using a taxonomy file
... Hi Josh, I updated my initial question as you suggested. I have also been looking through the biom-format documentation and it looks like this may be the best way forward. This is the first time that I have generated OTU tables, which felt like an accomplishment itself, but I am now stuck and wonde ...
written 17 months ago by jack112030
0
votes
0
answers
1.0k
views
0
answers
Relabel/rename OTU IDs in an OTU table using a taxonomy file
... Hi all, I tried to search the forum exhaustively for related topics, so I hope that this is a new and useful question. I have an OTU table in which each OTU is named with a sha1 label from an earlier step in my pipeline. I also generated a tab-separated taxonomy table using sequences associated wi ...
rename otu taxonomy relabel sequencing written 17 months ago by jack112030
1
vote
2
answers
649
views
2
answers
Comment: C: Reformatting fasta headers
... This works perfectly. Thank you, Alex! ...
written 19 months ago by jack112030
0
votes
2
answers
649
views
2
answers
Comment: C: Reformatting fasta headers
... That's fair. I understand the frustration and apologize for the poor etiquette. I did search some general programming sites beforehand, but lazily plopped my question here looking a quick fix after that. I'll be better! ...
written 19 months ago by jack112030
9
votes
2
answers
649
views
8 follow
2
answers
Reformatting fasta headers
... I need to reformat headers in a fasta file with headers such as: >Agaricus_chiangmaiensis|JF514531|SH174817.07FU|reps|k__Fungi;p__Basidiomycota;c__Agaricomycetes;o__Agaricales;f__Agaricaceae;g__Agaricus;s__Agaricus_chiangmaiensis TTGAATTATGTTTTCTAGATGGGTTGTAGCTGGCTCTTCGGAGCATGTGCACGCCTGC ...
fasta headers next-gen sequencing written 19 months ago by jack112030 • updated 19 months ago by Pierre Lindenbaum122k
1
vote
1
answer
792
views
1
answer
Trouble preparing paired-end (MiSeq 2x250), double-tagged and dual-indexed reads from metabarcoding study for DADA2 pipelin
... I have paired-end reads (file_name_R1.fastq & file_name_R2.fastq) from a metabarcoding study that were originally amplified with forward and reverse primers that each had tags (6-8 bp with unique combinations for each sample) on the 5' ends, and which were also dual-indexed prior to sequencing. ...
metabarcoding dada2 amplicon next-gen sequencing written 20 months ago by jack112030 • updated 6 months ago by magda.wutkowska0

Latest awards to jack1120

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 816 users visited in the last hour