User: khikho

gravatar for khikho
Last seen:
1 year, 2 months ago
8 years, 1 month ago

Posts by khikho

<prev • 25 results • page 1 of 3 • next >
Comment: C: Spliced aligners for RNA-seq
... Segemehl ...
written 4.7 years ago by khikho100
Answer: A: Remove reads from bam file whose mate has been already filtered out
... Use the concept priority queue if you want to implement it by yourself otherwise use bam-fixpair command of package biohazard . ...
written 5.0 years ago by khikho100
reheadering, merging and sorting on different bam file
... Hi, Imagine that I have 20 bam files, which I want to change their header then merge them and then sort them! So I just wondering if these two scenarios make different output : 1) reheader (each of them) -> merge all -> sort the output 2) merge all -> reheader the output -> sort  All ...
sequence bam written 6.1 years ago by khikho100 • updated 6.1 years ago by Dan D7.1k
Approximate Nucleosome Position
... I wanna know the coverage of the reads surround/outside of the nucleosome. The reads are Human (illumina mate pair), Any suggestion would be greatly appreciated. P.S Do you think aligning them by ensemble could be an option !? ...
illumina ngs written 6.4 years ago by khikho100 • updated 4.0 years ago by Biostar ♦♦ 20
5 follow
Gatk Ouput : Duplication On Same Position
... Is there any explanition for having these two lines on the same position? and Is there any way to pick almost the best one in this case automaticly? 21 26039812 . G . 90.19 . GT:DP:GQ:PL:A:C:G:T:IR 0/0:20:60.20:0,60,807:0,0:0,0:14,6:0,0:8 21 26039812 ...
vcf gatk written 6.7 years ago by khikho100 • updated 6.7 years ago by vdauwera960
Ncbi Taxonomy
... When I searched the NCBI Taxonomy db for id=693 it has retrieved the result but the tax_id in the result is different by the ID which I searched and I just find out this tax_id (603) is related to gi=156 ...
ncbi written 7.8 years ago by khikho100 • updated 6.8 years ago by Biostar ♦♦ 20
Comment: C: Blastx Result
... Because of formatting I put them in Answer part ...
written 8.0 years ago by khikho100
Answer: A: Blastx Result
... Question 1 Solved [It's human mistake] NODE_2160645-0;57 GTAAGGTGAGAAAAAAAAAAAACGGAAGACTTGCCTTTCTCCAGTCCATTCCGTTCAATC CATTCCATTCCAGTCCATTCCA blastx -query contigs.out -db nr ..... version: 2.2.24+ Query= NODE_2160645-0;57 Length=82 Sequences producing significant alignments: ...
written 8.0 years ago by khikho100 • updated 8.0 years ago by Michael Dondrup47k
Blastx Result
... I'm almost confused on blastx output length result. So the questions are: Query= NODE_2160645-0;57 Length=82 ref|XP_002833304.1| PREDICTED: hypothetical protein LOC100444373 [Pongo abelii] Length=134 Score = 37.7 bits (86), Expect = 0.74 Identities = 11/14 (78%), Positive ...
written 8.0 years ago by khikho100
Bioscope Output Format?
... I want to extract reads and ColorQualitys from unmapped reads of bioscope output, here is one line sample : 788_2043_1964 141 * 0 0 * * 0 0 * * RG:Z:20110319033913614 CQ:Z:%+&%%&(%()%&%&%%-).+&'2-0)%485/(%). CS:Z:G31102022112011103111111111 ...
mapping written 8.1 years ago by khikho100 • updated 8.1 years ago by GAO Yang250

Latest awards to khikho

Popular Question 4.7 years ago, created a question with more than 1,000 views. For Retrieve Information From Ucsc Genome Browser ?
Popular Question 4.7 years ago, created a question with more than 1,000 views. For De Novo Assembly Using Colorspace
Popular Question 4.7 years ago, created a question with more than 1,000 views. For Blastx Result
Popular Question 4.7 years ago, created a question with more than 1,000 views. For Gatk Ouput : Duplication On Same Position
Popular Question 4.7 years ago, created a question with more than 1,000 views. For Ncbi Taxonomy
Popular Question 4.7 years ago, created a question with more than 1,000 views. For Insert Length Estimated By Velvet
Popular Question 4.7 years ago, created a question with more than 1,000 views. For Bioscope Output Format?
Popular Question 4.7 years ago, created a question with more than 1,000 views. For Explanation Of Low Mapping Quality!
Popular Question 4.7 years ago, created a question with more than 1,000 views. For Velvet Postprocessing
Popular Question 5.8 years ago, created a question with more than 1,000 views. For De Novo Assembly Using Colorspace
Popular Question 5.8 years ago, created a question with more than 1,000 views. For Explanation Of Low Mapping Quality!
Supporter 6.1 years ago, voted at least 25 times.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1262 users visited in the last hour