User: sneha108ss

gravatar for sneha108ss
sneha108ss10
Reputation:
10
Status:
New User
Location:
Last seen:
3 days, 22 hours ago
Joined:
1 year, 6 months ago
Email:
s*********@gmail.com

Posts by sneha108ss

<prev • 12 results • page 1 of 2 • next >
0
votes
2
answers
155
views
2
answers
Answer: A: Trimmomatic is removing excessive reads after trimmimg
... I've added the images using Imgur, so it should be working now! I am not performing transcriptome assembly as I have a reference genome against which I'll be mapping my reads. I do understand that filtering at quality 30 might be too strict, but based on the fastqc results, I still wouldn't expect ...
written 11 days ago by sneha108ss10
0
votes
2
answers
155
views
2
answers
Comment: C: Trimmomatic is removing excessive reads after trimmimg
... Hi, Thank you for your reply! I have updated the links to the figures, hopefully you can see them now! According to the fastqc results, the per base sequence quality is above 30 for read 1 and drops slightly below 30 only towards the end of read 2, which is why I decided to trim them at quality 30. ...
written 14 days ago by sneha108ss10
0
votes
2
answers
155
views
2
answers
Trimmomatic is removing excessive reads after trimmimg
... Hi, I have some RNA-seq datasets and I wanted to remove adapters and low quality bases before proceeding with my analysis. The final goal of my analysis is to perform differential gene expression between my control and experimental conditions. I used fastqc to check the quality of my sequences and i ...
trimmomatic quality rna-seq written 14 days ago by sneha108ss10
2
votes
2
answers
817
views
2
answers
Difference between differential transcript expression and differential splicing
... Hi, Is there a difference between differential transcript expression and differential splicing? To me both seem the same ...
splicing expression transcript written 12 months ago by sneha108ss10 • updated 12 months ago by Charles Warden7.2k
0
votes
0
answers
334
views
0
answers
HTSeq-count: Type error
... Hi, I have the following error when trying to run HTSeq-count : "Error occured when processing SAM input (record #33999407 in file ConAc_A2-11D.sorted.bam): Expected str, got NoneType [Exception type: TypeError, raised in _HTSeq.pyx:59]" Could someone please help me to fix this e ...
rna-seq written 14 months ago by sneha108ss10 • updated 14 months ago by genomax70k
0
votes
1
answer
1.6k
views
1
answers
Answer: A: How to create "design" for RNA-seq experiment using limma?
... Hi, I am also facing a similar problem. How did you create the design matrix?? ...
written 15 months ago by sneha108ss10
0
votes
0
answers
902
views
0
answers
Comment: C: running dexseq_count.py on the command line
... Thank you so much for your help. The BAM files looked fine on my computer but when I uploaded it onto the cluster something went wrong. Anyways I tried uploading it again and now samtools flagstat control.sorted.bam gives the following output: 36866957 + 0 in total (QC-passed reads + QC-failed ...
written 18 months ago by sneha108ss10 • updated 18 months ago by genomax70k
0
votes
0
answers
902
views
0
answers
Comment: C: running dexseq_count.py on the command line
... Sorry for the crowded text, This is how the alignment section of the BAM file looks like. HWI-ST913:353:C83BLACXX:8:2310:18405:24062 403 DAPPUscaffold_15319 706 0 98M = 613 -191 TAAAGTGGGCCCATTTCTCCGTCAAAGTGGGCCTATTTCTCCCAATTATTTCTAAGTTCCATTAGGTACTCTGAAATATATTCAATAAAAAATTCGAC @CC?& ...
written 18 months ago by sneha108ss10
0
votes
0
answers
902
views
0
answers
Comment: C: running dexseq_count.py on the command line
... The alignment was done using STAR The alignment section of the BAM file does look like what you have sent. HWI-ST913:353:C83BLACXX:8:2310:18405:24062 403 DAPPUscaffold_15319 706 0 98M = 613 -191 TAAAGTGGGCCCATTTCTCCGTCAAAGTGGGCCTATTTCTCCCAATTATTTCTAAGTTCCATTAGGTACTCTGAAATATATTCAATAAAAAATTCGAC ...
written 18 months ago by sneha108ss10 • updated 18 months ago by genomax70k
0
votes
0
answers
902
views
0
answers
Comment: C: running dexseq_count.py on the command line
... Thank you. I was able to run dexseq_count.py using the gff file generated with dexseq_prepare_annotation.py. This is the code I used: samtools view control.sorted.bam | python dexseq_count.py -p yes -s yes -r pos control_annotation_result.gff - control.count.txt But when I ...
written 18 months ago by sneha108ss10

Latest awards to sneha108ss

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1433 users visited in the last hour