User: claudiadast

gravatar for claudiadast
Reputation:
0
Status:
New User
Last seen:
4 months, 3 weeks ago
Joined:
1 year, 1 month ago
Email:
c*****************@ucsf.edu

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by claudiadast

<prev • 12 results • page 1 of 2 • next >
0
votes
0
answers
272
views
0
answers
Comment: C: Using samtools to assess the number of reads that cover a variant position, as w
... Thanks! So going off of my example above, I did `samtools depth -r chr2:86042011-86042011 myBAM.bam` and got: chr2 86042011 3 So how does that read depth number then get factored in to the `samtools mpileup` command? Does that mean the interval has to be `86042011- 86042014` or how d ...
written 5 months ago by claudiadast0
1
vote
0
answers
272
views
0
answers
Using samtools to assess the number of reads that cover a variant position, as well as the ratio of ref/alt among those reads
... I currently have variant data per sample and the corresponding RNA seq BAMs per sample. What I'm trying to do is tap into the corresponding bam files, determine the number of reads associated with the variant, and then deduce the %ref and %alt alleles in those reads. So for instance, I have a vari ...
allele balance bam samtools rna-seq mpileup written 5 months ago by claudiadast0
4
votes
1
answer
277
views
1
answer
Error when running Ensembl VEP: "bigWigToWig does not seem to be in your path"
... I am trying to run VEP (version 77), but when I run the program, I get the error: ``` 2018-10-12 18:54:08 - Read existing cache info ERROR: bigWigToWig does not seem to be in your path - this is required to use bigwig format custom annotations ``` How can I get bigWigtoWig in my path? ...
ensembl ngs vep snp bigwig written 5 months ago by claudiadast0 • updated 4 months ago by Biostar ♦♦ 20
0
votes
1
answer
294
views
1
answers
Comment: C: Is there a tool or efficient method of confirming that a FASTQ file and BAM file
... By processed bams, I mean bams that have been sorted, deduped, and recalibrated. By unprocessed, I mean just a sorted bam file (produced by Picard SortSam). And no, my bam files contain only aligned reads. ...
written 6 months ago by claudiadast0
0
votes
1
answer
294
views
1
answers
Comment: C: Is there a tool or efficient method of confirming that a FASTQ file and BAM file
... Thank you! Do you happen to know if this tool is meant to take in processed or un-processed bams as input? Also, the result of this tool produces two separate hashes - should both hashes match when comparing to another file? Or is it sufficient for only one of the hashes to match? ...
written 6 months ago by claudiadast0
2
votes
1
answer
294
views
1
answer
Is there a tool or efficient method of confirming that a FASTQ file and BAM file contain the same reads?
... Is there an existing tool to verify that a FASTQ file and a BAM file possess the same reads? ...
genome alignment written 6 months ago by claudiadast0 • updated 6 months ago by genomax64k
0
votes
0
answers
249
views
0
answers
Comment: C: Getting "Mismatch between read length and quals length" error in SortSam.
... The output is: E00170:444:HG3MJALXX:2:1210:10216:16059 99 chr2 91792176 42 151M = 91792243 218 AGCCCTTCTCAATAGCCATTTTGAAATATATCAAGGAAATATATTTAGGGGTAAAATATATTAGTTTCCCTCATACAGCTATAAAACATACAGGAATAATTTTTGTCAATGTCTACTACAAATCCAATATAGCAGTAATTATAAAACTCAC ?< ...
written 6 months ago by claudiadast0
1
vote
0
answers
249
views
0
answers
Getting "Mismatch between read length and quals length" error in SortSam.
... I am running Picard's SortSam (with VALIDATION_STRINGENCY = LENIENT) and I'm getting the following error. The SAM file was generated using BWA mem. I'm not familiar with this issue and haven't found much information on it. How can I resolve this? Here is the stack trace: Exception in thread "m ...
genome picard sortsam written 6 months ago by claudiadast0
0
votes
1
answer
268
views
1
answers
Comment: C: SortSam is failing due to Error Parsing SAM file: ("Tag of type i should have si
... It was generated using bwa mem. ...
written 6 months ago by claudiadast0
2
votes
1
answer
268
views
1
answer
SortSam is failing due to Error Parsing SAM file: ("Tag of type i should have signed decimal value")
... I am attempting doing variant-calling on a genomic sample, however it failed at the SortSam step due to the following: Exception in thread "main" htsjdk.samtools.SAMFormatException: Error parsing text SAM file. Tag of type i should have signed decimal value; File HBCC-DNA-CER-13309.sam; Line 1 ...
genome sort sam picard sam written 6 months ago by claudiadast0 • updated 6 months ago by Pierre Lindenbaum118k

Latest awards to claudiadast

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 940 users visited in the last hour