User: athira112athira

Reputation:
0
Status:
New User
Last seen:
4 months, 1 week ago
Joined:
1 year, 3 months ago
Email:
a**************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by athira112athira

<prev • 15 results • page 1 of 2 • next >
0
votes
3
answers
4.9k
views
3
answers
Answer: A: Fastx Barcode Splitter
... Thank you ,it is also helpful for me. ...
written 4 months ago by athira112athira0
0
votes
1
answer
184
views
1
answers
Comment: C: Fastx quality filtering error
... Thank you for your suggestion. I will try anyone of it as possible. ...
written 4 months ago by athira112athira0
0
votes
0
answers
138
views
0
answers
Error in sabre installation
... Hi, I am working with NGS metagenomic data. DNA isolated from gastric biopsy using the THSTI method, followed by PCR amplification of the V1-5 regions and sequencing using the 454 FLX+ approaches. Contains amplicon reads from all 41 samples. All the 39 samples were sequenced in a single multiplexed ...
software error next-gen written 4 months ago by athira112athira0
0
votes
1
answer
184
views
1
answers
Comment: C: Fastx quality filtering error
... Thank you so much, I will take care about it from the very next post. ...
written 4 months ago by athira112athira0
0
votes
1
answer
184
views
1
answers
Comment: C: Fastx quality filtering error
... This is the output for head -n 4 sra_data.fastq `dcb@dcb-P6-2355IL:~$ head -n 4 sra_data.fastq` @SRR6031690.1.1 I2SY8KZ01A1O0T length=510 CGCAACATTACCGCGGCTGCTGGCACGTAGTTAGCCGTCCTCTTGGTAAGATACCGTCACAGTGTGAACTTTCCACTCTCACACTCATTCTTCTCTTACAACAGAGCTTTACGATCCGAAACCTTCTTCACTCACGCGGCGTTGCTCGGT ...
written 4 months ago by athira112athira0 • updated 4 months ago by Bastien Hervé4.2k
0
votes
1
answer
184
views
1
answer
Fastx quality filtering error
... Hi, I use fast-x toolkit for quality filtering of my data. I get an error when running the command fastq_quality_filter -v -Q 64 -q 25 -p 75 -i sra_data.fastq -o sample_filtered.fastq fastq_quality_filter: Invalid quality score value (char '.' ord 46 quality value -18) on line 4 I ne ...
software error fastx written 4 months ago by athira112athira0 • updated 4 months ago by finswimmer11k
0
votes
1
answer
251
views
1
answers
Answer: A: Tool for 16s rRNA selection in metagenomic data
... Thank you for the replay , I want to know about both data. ...
written 4 months ago by athira112athira0
0
votes
1
answer
251
views
1
answers
Comment: C: Tool for 16s rRNA selection in metagenomic data
... I am trying to install tools called reago and EMIRGE, show errors during installation. ...
written 4 months ago by athira112athira0
0
votes
1
answer
251
views
1
answer
Tool for 16s rRNA selection in metagenomic data
... Hi, I am working with metagenomic data. I need a tool for rRNA selection from it. can anyone suggest a better tool for this ??? ...
genome next-gen written 4 months ago by athira112athira0
0
votes
0
answers
236
views
0
answers
Comment: C: Error in reago installation
... Thank you for the replay , I am using python 3.6.6 in linux os 14.04, conda 4.5.12 ...
written 4 months ago by athira112athira0

Latest awards to athira112athira

Popular Question 6 months ago, created a question with more than 1,000 views. For What is unigene

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 634 users visited in the last hour