User: rmash

gravatar for rmash
rmash0
Reputation:
0
Status:
New User
Last seen:
5 days ago
Joined:
1 year, 3 months ago
Email:
r*************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by rmash

<prev • 15 results • page 1 of 2 • next >
0
votes
1
answer
94
views
1
answers
Answer: A: RNAseq - how to find novel transcripts in under different treatment using string
... The stringTie pipeline generates a merged GTF which you then use to use as a reference to get transcript count tables for all your sample. ...
written 5 days ago by rmash0
0
votes
1
answer
558
views
1
answers
Answer: A: WGCNA consensus network issue creating module-trait relationship
... Did you ever solve this. I am having the same issue. I think it has somehting to do with how my mulitExpr dataset is structured. ...
written 6 days ago by rmash0
0
votes
0
answers
141
views
0
answers
Comment: C: WGCNA soft-threshold power selection
... This is covered in the FAQ of the WCGNA webpage https://horvath.genetics.ucla.edu/html/CoexpressionNetwork/Rpackages/WGCNA/faq.html See #6: "I can't get a good scale-free topology index no matter how high I set the soft-thresholding power." It kind of depends on your data and how many samples you h ...
written 7 days ago by rmash0
0
votes
0
answers
116
views
0
answers
Importing eggnog annotations into topGO or similar?
... I'm working with a non-model organism. I took some genes of interest and mapped it to eggnog. I got an annotation file that has a column with sometimes multiple GO terms per row. What is the best way to look at GO term enrichment? I can import the relevant columns (ID) and column with GO terms in ...
non-model organism eggnog go terms rna-seq written 9 days ago by rmash0 • updated 5 days ago by Biostar ♦♦ 20
0
votes
4
answers
596
views
4
answers
Comment: A: Run a GO analysis for an non-model organism with annotation file
... This might be the wrong thread to ask but how does one take eggnog mapping results (which provides a column with GO terms) and import it for topGO or something similar? ...
written 9 days ago by rmash0
0
votes
2
answers
470
views
2
answers
Answer: A: Extracting counts of reads into a matrix
... This seems to work awk '{seen[$4]++} END{for(x in seen) print x, seen[x]}' test.txt > test_counts.txt Is there a better option? ...
written 16 months ago by rmash0
0
votes
2
answers
470
views
2
answers
Comment: C: Extracting counts of reads into a matrix
... thats correct, have edited main post to make it clearer ...
written 16 months ago by rmash0
0
votes
2
answers
470
views
2
answers
Comment: C: Extracting counts of reads into a matrix
... yes thats what id like to do but dont know how to in unix ...
written 16 months ago by rmash0
0
votes
2
answers
470
views
2
answers
Comment: C: Extracting counts of reads into a matrix
... Yes, I was doing something silly, but I've fixed it and there should now be repeats, as the 4th item in each line, how would I go about making a count matrix from this? Sorry, i'm a novice ...
written 16 months ago by rmash0
0
votes
2
answers
470
views
5 follow
2
answers
Extracting counts of reads into a matrix
... I have a txt file with sequences 1 TACCCTGTAGAACCGAATTTGT miRNA mmu-mir-10b PM 2 GCATTGGTGGTTCAGTGGTAGAATTCTCGCCT tRNA Mus_musculus_tRNA-Gly-GCC-4-1 PM 3 TACCCTGTAGATCCGAATTTGT miRNA mmu-mir-10a PM 4 GCATTGTGGTTCAGTGGTAGAATTCTCGCCT tRNA Mus_musculus_tRNA-Gly-GCC-2-2 IM 5 ACCCTGT ...
reads grep counts unix written 16 months ago by rmash0 • updated 16 months ago by cpad011211k

Latest awards to rmash

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 958 users visited in the last hour