User: ulises.rodriguez

Reputation:
0
Status:
New User
Last seen:
2 days, 1 hour ago
Joined:
2 months, 1 week ago
Email:
u***************@cinvestav.mx

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by ulises.rodriguez

<prev • 8 results • page 1 of 1 • next >
0
votes
0
answers
101
views
0
answers
phylogenetics trees in r
... Good afternoon, I know that this blog is not precisely about phylogenetics subjects, but I'm stuck using **phylotools in R** , I'm trying to mapping a matrix which contains continue values in a phylogenetic tree. It seems that my tree has zero and negative edges lengths, and when I try to map the m ...
R written 8 days ago by ulises.rodriguez0
4
votes
1
answer
203
views
10 follow
1
answer
(Closed) split text file in multiples text files
... Hello, I Have a file text that looks like this number1.1 characters_string_1 number1.2 characters_string_2 number1.3 characters_string_3 number2.1 characters_string_1 number2.2 characters_string_2 number2.3 characters_string_3 number3.1 character ...
sequence written 6 weeks ago by ulises.rodriguez0 • updated 6 weeks ago by anicet.ebou130
6
votes
3
answers
205
views
3
answers
change headers from fasta files
... I have multifasta files containing sequences like these: >16S_ribosomal_RNA attgcaggtcagcatactgcagtgaattcgttcc >16S_ribosomal_RNA attgcaggtcagcatactgcagtgaattcgttcc >16S_ribosomal_RNA attgcaggtcagcatactgcagtgaattcgttcc these sequences are contained in fas ...
sequence written 7 weeks ago by ulises.rodriguez0 • updated 7 weeks ago by cpad01127.7k
1
vote
1
answer
143
views
1
answer
extraction of the 16s rRNA gene from a file containing the genome
... Hello everyone, I have a fasta files containing genomes of bacterias and I would like to extract only 16s rRNA gene, I have tried with R packages like "micropan" with the function barrnap using the following code `barrnap(genome.file = "file_containing_genome.fasta",bacteria = T,cpu = 8)` and the o ...
genome gene sequence written 7 weeks ago by ulises.rodriguez0 • updated 7 weeks ago by sacha1.3k
0
votes
0
answers
210
views
0
answers
Comment: C: statistics data, observed vs expected values
... this is a sample of the data, I have approximately 3500 genomes https://i0000.clarodrive.com/s/oxfB4puIAmmrCrf ...
written 8 weeks ago by ulises.rodriguez0
0
votes
0
answers
210
views
0
answers
statistics data, observed vs expected values
... I have a data.frame () with the values of the observed and expected frequency of a kmer in multiples genomes, and I would like to obtain a threshold value to classify the genomes according to their observed and expected values. I have been trying with Chi-square test and G-test, but I'm not sure the ...
R written 8 weeks ago by ulises.rodriguez0 • updated 7 weeks ago by Biostar ♦♦ 20
1
vote
1
answer
107
views
1
answer
DNA-binding sites to proteins in bacteria
... is there a data base for all dna-binding sites to proteins for the bacteria domain? ...
sequence written 9 weeks ago by ulises.rodriguez0 • updated 9 weeks ago by Alex Reynolds24k
9
votes
4
answers
203
views
6 follow
4
answers
headers from multifasta files
... I have a folder with multifasta files and I would like to extract the headers from each one of them, I've used the following command in shell grep -e ">" *.fasta > prueba_nc.txt the output looks like it Adenoviridae_genomas.fasta:>AC_000001 [AC_000001] Ovine adenovirus A, comp ...
sequence written 9 weeks ago by ulises.rodriguez0 • updated 9 weeks ago by Vijay Lakhujani2.8k

Latest awards to ulises.rodriguez

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 755 users visited in the last hour