User: ulises.rodriguez

New User
Last seen:
4 months, 1 week ago
9 months, 1 week ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by ulises.rodriguez

<prev • 10 results • page 1 of 1 • next >
cut columns in txt tab separated file
... Hi, I have a table with separated columns, and I would like to separate it into individual columns keeping the name of the column and the name of the rows I have tried in command line linux with cut cat table.txt | cut -f1 -d\t But it does not work, I have also tried with split in R ...
R linux bash written 4 months ago by ulises.rodriguez0 • updated 4 months ago by RamRS20k
PAML ancestral sequences reconstruction
... Hello, I have a set of about 9,000 groups of orthologous proteins I'm trying to do ancestral sequence reconstructions for each of these groups based on their phylogenies, and then to compare each nucleotide position in a species of interest to the reconstructed sequences at key ancestral nodes. I ...
sequence alignment written 5 months ago by ulises.rodriguez0
phylogenetics trees in r
... Good afternoon, I know that this blog is not precisely about phylogenetics subjects, but I'm stuck using **phylotools in R** , I'm trying to mapping a matrix which contains continue values in a phylogenetic tree. It seems that my tree has zero and negative edges lengths, and when I try to map the m ...
R written 7 months ago by ulises.rodriguez0
10 follow
(Closed) split text file in multiples text files
... Hello, I Have a file text that looks like this number1.1 characters_string_1 number1.2 characters_string_2 number1.3 characters_string_3 number2.1 characters_string_1 number2.2 characters_string_2 number2.3 characters_string_3 number3.1 character ...
sequence written 8 months ago by ulises.rodriguez0 • updated 8 months ago by anicet.ebou140
change headers from fasta files
... I have multifasta files containing sequences like these: >16S_ribosomal_RNA attgcaggtcagcatactgcagtgaattcgttcc >16S_ribosomal_RNA attgcaggtcagcatactgcagtgaattcgttcc >16S_ribosomal_RNA attgcaggtcagcatactgcagtgaattcgttcc these sequences are contained in fas ...
sequence written 8 months ago by ulises.rodriguez0 • updated 8 months ago by cpad011211k
extraction of the 16s rRNA gene from a file containing the genome
... Hello everyone, I have a fasta files containing genomes of bacterias and I would like to extract only 16s rRNA gene, I have tried with R packages like "micropan" with the function barrnap using the following code `barrnap(genome.file = "file_containing_genome.fasta",bacteria = T,cpu = 8)` and the o ...
genome gene sequence written 8 months ago by ulises.rodriguez0 • updated 8 months ago by sacha1.6k
Comment: C: statistics data, observed vs expected values
... this is a sample of the data, I have approximately 3500 genomes ...
written 9 months ago by ulises.rodriguez0
statistics data, observed vs expected values
... I have a data.frame () with the values of the observed and expected frequency of a kmer in multiples genomes, and I would like to obtain a threshold value to classify the genomes according to their observed and expected values. I have been trying with Chi-square test and G-test, but I'm not sure the ...
R written 9 months ago by ulises.rodriguez0 • updated 8 months ago by Biostar ♦♦ 20
DNA-binding sites to proteins in bacteria
... is there a data base for all dna-binding sites to proteins for the bacteria domain? ...
sequence written 9 months ago by ulises.rodriguez0 • updated 9 months ago by Alex Reynolds27k
6 follow
headers from multifasta files
... I have a folder with multifasta files and I would like to extract the headers from each one of them, I've used the following command in shell grep -e ">" *.fasta > prueba_nc.txt the output looks like it Adenoviridae_genomas.fasta:>AC_000001 [AC_000001] Ovine adenovirus A, comp ...
sequence written 9 months ago by ulises.rodriguez0 • updated 9 months ago by biokoala3.6k

Latest awards to ulises.rodriguez

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 700 users visited in the last hour