User: drkennetz

gravatar for drkennetz
drkennetz340
Reputation:
340
Status:
Trusted
Location:
Last seen:
1 week, 2 days ago
Joined:
4 months, 1 week ago
Email:
d********@gmail.com

Posts by drkennetz

<prev • 55 results • page 1 of 6 • next >
0
votes
1
answer
95
views
1
answers
Comment: C: Does Cutadapt change the x,y coordinates in the fastq read name?
... Thank you! I see in the documentation that it says plainly that paired reads should always be used together (this seems like a no-brainer). Definitely a pretty bad oversight on my part. ...
written 6 weeks ago by drkennetz340
0
votes
1
answer
95
views
1
answers
Comment: C: Does Cutadapt change the x,y coordinates in the fastq read name?
... Thanks for the info, I have not done any kind of trimming so this has been good to know! Do you have any preference for adapter trimming software? ...
written 6 weeks ago by drkennetz340
3
votes
1
answer
95
views
1
answer
Does Cutadapt change the x,y coordinates in the fastq read name?
... Hi all, I have found a high presence of Illumina adapter content in a batch of samples which were sequenced on a NovaSeq. I set out to trim the adapters using cutadapt: R1: cutadapt -a GATCGGAAGAGCACGTCTGAACTCCAGTCAC -o outputR1.fastq.gz R1_001.fastq.gz R2: cutadapt -a AGATCGGAA ...
next-gen alignment written 6 weeks ago by drkennetz340
0
votes
1
answer
119
views
1
answers
Comment: C: Are CWL CommandLineTool arguments guaranteed to be contiguous?
... Okay, that sounds weird to me since -1 implies the last element in a list (and the command line is a list of arguments/inputs). Either way see below, by forcing the position using `inputBinding: position` you guarantee their order. ...
written 6 weeks ago by drkennetz340
0
votes
1
answer
119
views
1
answers
Comment: C: Are CWL CommandLineTool arguments guaranteed to be contiguous?
... -1 put a at the front? ...
written 6 weeks ago by drkennetz340
2
votes
1
answer
119
views
1
answers
Answer: A: Are CWL CommandLineTool arguments guaranteed to be contiguous?
... This can be solved by giving everything an inputBinding: position:. Doing this will ensure the behavior you are looking for. For example, if you want your arguments to appear first and your inputs to appear second you can do the following: cwlVersion: v1.0 class: CommandLineTool require ...
written 6 weeks ago by drkennetz340
0
votes
2
answers
169
views
2
answers
Answer: A: How to create a list of the barcodes located in the read headers of demultiplexe
... When you say a list my mind is immediately going to python but you haven't tagged it so I will give an awk solution for you: zcat file.fastq.gz | awk 'NR == 1 || NR % 4 == 0 ' | awk -F ':' '{print $12} Your fastq is a little weird in the header line, but This will print the first line, and ev ...
written 7 weeks ago by drkennetz340
0
votes
1
answer
158
views
1
answers
Answer: A: bedtools bamtobed of mixed paired-end and non-paired datasets
... Hi tassa, samtools view -F 0x40 -h merged.bam > R1_from_merged.sam samtools view -F 0x80 -h merged.bam > R2.sam_from_merged samtools view -S -b R1.sam > R1_from_merged.bam samtools view -S -b R2.sam > R2_from_merged.bam I think you could do the -b flag in the first step ...
written 7 weeks ago by drkennetz340
1
vote
1
answer
146
views
1
answers
Comment: C: DNA Methylation induced by emotions or other psycological factor
... If his response answered your question you should give it a thumbs up, and click the check mark underneath signifying that your question has found an accepted response. ...
written 8 weeks ago by drkennetz340
0
votes
2
answers
186
views
2
answers
Comment: C: If a string appears twice in column 1, select the higher value in column 2
... worked like a charm! Thanks for the help. ...
written 9 weeks ago by drkennetz340

Latest awards to drkennetz

Rising Star 6 weeks ago, created 50 posts within first three months of joining.
Scholar 9 weeks ago, created an answer that has been accepted. For A: How to count the total aligned bases in BAM?
Teacher 9 weeks ago, created an answer with at least 3 up-votes. For A: How to count the total aligned bases in BAM?
Supporter 12 weeks ago, voted at least 25 times.
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: How to count the total aligned bases in BAM?
Scholar 3 months ago, created an answer that has been accepted. For A: How to count the total aligned bases in BAM?
Scholar 3 months ago, created an answer that has been accepted. For A: How to count the total aligned bases in BAM?
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: How to count the total aligned bases in BAM?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 722 users visited in the last hour