User: Nandini

gravatar for Nandini
Nandini860
Reputation:
860
Status:
Trusted
Location:
Scholar ID:
Google Scholar Page
Last seen:
8 months, 2 weeks ago
Joined:
8 years, 5 months ago
Email:
n********************@gmail.com

Bioinformatician

Develop and maintain pipeline(s) for WES, Targeted gene sequencing, mtDNA NGS analysis

Posts by Nandini

<prev • 209 results • page 1 of 21 • next >
0
votes
0
answers
374
views
0
answers
Comment: C: Calculate coverage from SAM file
... unfortunately not. these are really old clinical samples that have been sent across. ...
written 8 months ago by Nandini860
1
vote
0
answers
374
views
0
answers
Calculate coverage from SAM file
... I have a really old sam format file that does not have any header or information on what build it has been aligned to. It looks something like this NS500377:28:H16A7BGXX:3:21410:1181:5368 99 chr11 3000035 255 40M = 3000039 44 GTTTTTCACTGTTTCTCCCCATATTCCAGGTCTTACAGT ...
no header samtools sam coverage written 8 months ago by Nandini860 • updated 8 months ago by onestop_data260
0
votes
1
answer
2.8k
views
1
answers
Comment: C: If the odds ratio of a SNP is < 1, does that mean the minor allele is protective
... I know this is irrelevant now but being a part of this project, I feel the need to mention that we did correct for covariates such as age, sex and principal components to adjust for possible population stratification. It is also mentioned in the methods section of the paper ...
written 14 months ago by Nandini860
1
vote
2
answers
824
views
2
answers
Comment: C: Convert vcf phased data to plink
... Ah, for now, I was able to sort my issue out using the R package SNPrelate. It takes in the vcf file as input, calculates IBS and then if one feels like it, it can also convert it to PLINK format ! ...
written 15 months ago by Nandini860
0
votes
2
answers
824
views
2
answers
Comment: C: Convert vcf phased data to plink
... still the same. I don't think PLINK can handle phased Haplotype file in the format 0|1, where 0 indicates ref and 1 is for the alt allele. Can it ? ...
written 15 months ago by Nandini860
0
votes
2
answers
824
views
2
answers
Comment: C: Convert vcf phased data to plink
... No, so this is what I did (playing around with a chunk of chr22) ##convert vcf to plink ./plink --vcf input_genotype.vcf --keep-allele-order --allow-extra-chr 0 --make-bed --out MyData ##tried to calculate IBS using King /king -b MyData.bed --ibs The result from above is an ...
written 15 months ago by Nandini860
0
votes
2
answers
824
views
2
answers
Comment: C: Convert vcf phased data to plink
... thanks Kevin, I try to do that but end up wit a file that has 0 for each individual. ...
written 15 months ago by Nandini860
2
votes
2
answers
824
views
2
answers
Convert vcf phased data to plink
... I have a phased haplotype format vcf file that looks like this ##fileformat=VCFv4.0 ##reference=human_b36_both.fasta ##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA12891 NA12892 NA12878 NA19239 NA19238 NA19240 22 47812545 rs576981 ...
vcf phased-haplotype plink convert written 15 months ago by Nandini860 • updated 15 months ago by Gabriel R.2.8k
1
vote
1
answer
874
views
1
answers
Answer: C: hg19 interval list
... maybe not on the gatk bundle site. But probably a [liftover][1] should work ? [1]: https://genome.ucsc.edu/cgi-bin/hgLiftOver ...
written 17 months ago by Nandini860
1
vote
0
answers
1.0k
views
0
answers
Comment: C: Identify or update refseq transcript version on snpeff
... No, we haven't as yet. ...
written 17 months ago by Nandini860

Latest awards to Nandini

Popular Question 10 months ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Great Question 10 months ago, created a question with more than 5,000 views. For How to interpret heterozygosity rate ?
Epic Question 10 months ago, created a question with more than 10,000 views. For Calculate z-scores from GWAS summary stats
Popular Question 12 months ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Popular Question 12 months ago, created a question with more than 1,000 views. For Error in Snp set analysis using MetaSKAT
Popular Question 13 months ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Popular Question 15 months ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Popular Question 15 months ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Great Question 15 months ago, created a question with more than 5,000 views. For How to interpret heterozygosity rate ?
Popular Question 15 months ago, created a question with more than 1,000 views. For Error in Snp set analysis using MetaSKAT
Popular Question 19 months ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Popular Question 21 months ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Teacher 21 months ago, created an answer with at least 3 up-votes. For A: Single rare variant approaches
Popular Question 23 months ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Great Question 23 months ago, created a question with more than 5,000 views. For How to interpret heterozygosity rate ?
Great Question 23 months ago, created a question with more than 5,000 views. For Calculate z-scores from GWAS summary stats
Popular Question 2.0 years ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Popular Question 2.0 years ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Epic Question 2.2 years ago, created a question with more than 10,000 views. For Pros and cons of Illumina HiSeq and Next Seq
Popular Question 2.4 years ago, created a question with more than 1,000 views. For extract SNPs from compressed PLINK files
Popular Question 2.4 years ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Popular Question 2.5 years ago, created a question with more than 1,000 views. For How to interpret heterozygosity rate ?
Great Question 2.5 years ago, created a question with more than 5,000 views. For Pros and cons of Illumina HiSeq and Next Seq
Appreciated 2.6 years ago, created a post with more than 5 votes. For A: How To Revert Allele Data To Atgc With Plink After Recoding To 12 Format
Teacher 2.6 years ago, created an answer with at least 3 up-votes. For A: How To Revert Allele Data To Atgc With Plink After Recoding To 12 Format

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1785 users visited in the last hour