User: Laura_zz

gravatar for Laura_zz
Laura_zz0
Reputation:
0
Status:
New User
Last seen:
4 months, 2 weeks ago
Joined:
1 year, 5 months ago
Email:
s*********@foxmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Laura_zz

<prev • 6 results • page 1 of 1 • next >
0
votes
0
answers
242
views
0
answers
Comment: C: Why is the number of genes in certain a module in WGCNA super high?
... turquoise module. I used the block wise method to build the module, maxBlocwise set 20000. ...
written 4 months ago by Laura_zz0
1
vote
0
answers
242
views
0
answers
Why is the number of genes in certain a module in WGCNA super high?
... In my WGCNA analysis, I got a total of more than 20 modules. Most of the modules ranged in numbers from a few hundred to several thousand, but one module had a gene count of 13,000. I don't know what is wrong with this. ? My softpower value corresponds to R^2 up to only 0.74. Is this the reason? ...
wgcna written 4 months ago by Laura_zz0
2
votes
0
answers
257
views
0
answers
Why Ks value is NA in KaKs calculator
... My sequence is : >AAA ATGGTGGGGCAGACCATGATGCGCATCGTGCGGCCCTGCTTCAAGCCCTCGCTGCCCGACGGCGCGCAGGTCGTCGCCGCCGGGGGCGGCGGCACCAGGGAGGGCCTGCTCTGGTACAGGGACGCCGGCCGCCACGCCTGCGGCGACTTCTCCATGGCCGTCGTGCAGGCCAACCAGCTGCTCGAGGACGCCAGCCAGCTCGAGGCCGGGCCCCTCGTCGCCGCCGACGGGCCCTGCGCCACCTTCGTCGGCGTCTACGACGGCCA ...
software error gene kaks written 5 months ago by Laura_zz0 • updated 5 months ago by Biostar ♦♦ 20
0
votes
0
answers
341
views
0
answers
Comment: C: How to process RMA data of gene microarry ?
... > A<- read.csv(file="RMAdata.csv",header=TRUE,as.is=T) > A2<-A[,2:22] > A2<-as.matrix(A2) > rownames(A2)<-A[,1] > A3=log2(A2+1) > kk<- read.csv(file="design.csv",header=TRUE,as.is=T) >kk1<-kk[,2:11] > rownames(kk1)<-kk[,1] > mode(kk)<-"numer ...
written 6 months ago by Laura_zz0
1
vote
0
answers
341
views
0
answers
How to process RMA data of gene microarry ?
... I get RMA data from ArrayExpress, and it's single-channel data. I don't know much about gene chips, so I checked some information and tried to run the script provided by the limma package myself, but I don't know if it’s right. 1. One step of RMA data is to run exprs(RMA data), but I can't run it ...
R rna-seq written 6 months ago by Laura_zz0 • updated 6 months ago by Kevin Blighe52k
3
votes
2
answers
557
views
2
answers
How to optimize the homology modeling?
... I build a homology model used by Swiss-model, and evaluate the model by SAVEs, but how to further optimizing the model? what tools can I use? ...
pdb tool homology modeling written 17 months ago by Laura_zz0 • updated 17 months ago by Shamim Sarhadi210

Latest awards to Laura_zz

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1900 users visited in the last hour