User: afli

gravatar for afli
afli20
Reputation:
20
Status:
New User
Location:
China, Beijing, IGDB
Last seen:
7 minutes ago
Joined:
2 months, 2 weeks ago
Email:
a***@genetics.ac.cn

Posts by afli

<prev • 55 results • page 1 of 6 • next >
0
votes
0
answers
76
views
0
answers
Comment: C: Bowtie2 reads alignment question
... Thank you ATpoint, I would like to keep this multi-mapped reads as is recommanded in this post: https://www.biostars.org/p/163429/. ...
written 1 day ago by afli20
0
votes
0
answers
76
views
0
answers
Comment: C: Bowtie2 reads alignment question
... I add the option -a to display all the alignment. For index with chrM and chrC, V100002715L1C001R026000072 83 Chr06 8173354 1 50M = 8173235 -169 TTGTTTTTCTTGTTCTTCTTTCTCGAAGAGATGGGTGCACCGCCTTGGAG 7G@F4>FFG=FBFBFG*FBEF5AF?FFEEE?CD1D@CED=GFFGFGFFF/BCF>?FFFGFGCEFCFFFF6FE9FGF>F>FF>9 ...
written 1 day ago by afli20
1
vote
0
answers
76
views
0
answers
Bowtie2 reads alignment question
... Hi, I'm using bowtie2 to align reads to the genome, when I use the chr1 ~chr12 to build the index and then do mapping, the pair reads 'V100002715L1C001R026000072' is assigned to chr6 with good quality(mapping score 33). But if I add the chrC and chrM and build the new index, then do mapping, 'V10000 ...
bowtie2 written 1 day ago by afli20 • updated 1 day ago by RamRS17k
0
votes
1
answer
82
views
1
answers
Comment: C: Different result from WGCNA tutorial I
... Hi Kevin, you're right. I use R3.1.2, and WGCNA1.41.1, the result is the same with the tutorial. ...
written 2 days ago by afli20
1
vote
1
answer
82
views
1
answers
Comment: C: Different result from WGCNA tutorial I
... All right! Thank you Kevin! ...
written 3 days ago by afli20
0
votes
1
answer
226
views
1
answers
Comment: C: Eigen genes using WGCNA
... Hi Kevin, I have a small question about WGCNA, could you please give me some advice? the post are at: https://www.biostars.org/p/338879/. ...
written 3 days ago by afli20
2
votes
1
answer
82
views
1
answer
Different result from WGCNA tutorial I
... Dear friends, I am running the WGCNA tutorial code. In tutorial I, section2.c, my results are different from the tutorial(https://horvath.genetics.ucla.edu/html/CoexpressionNetwork/Rpackages/WGCNA/Tutorials/FemaleLiver-03-relateModsToExt.pdf). In detail, in the 2.c.2 of the 'FemaleLiver-03-relate ...
wgcna written 3 days ago by afli20 • updated 3 days ago by Kevin Blighe28k
0
votes
0
answers
946
views
0
answers
Comment: C: How to let WGCNA use multiple cores
... Do you mean that many threads work simultaneously? Could you please show your system information, and WGCNA version? I tried again and failed again... ...
written 27 days ago by afli20
0
votes
0
answers
946
views
0
answers
Comment: C: How to let WGCNA use multiple cores
... Thank you very much Kevin for your detailed reply! I accept the reality that I should use just one thread to run WGCNA at the moment. ...
written 28 days ago by afli20
0
votes
0
answers
946
views
0
answers
Comment: C: How to let WGCNA use multiple cores
... Thanks Kevin, I try the codes above and add enableWGCNAThreads(), but this could not increase the threads number. The program has cost more than 10 hs, and is still running for just one thread. One of my friends told me that WGCNA just uses one core. Maybe there're other methods to increase the thre ...
written 29 days ago by afli20

Latest awards to afli

Rising Star 3 days ago, created 50 posts within first three months of joining.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 756 users visited in the last hour