User: Shelle

gravatar for Shelle
Shelle0
Reputation:
0
Status:
New User
Last seen:
11 hours ago
Joined:
3 weeks, 2 days ago
Email:
s**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Shelle

<prev • 10 results • page 1 of 1 • next >
0
votes
0
answers
212
views
0
answers
Comment: C: Alignment with BWA and SAMtools
... Thanks for comment. I am able to see reads are mapped elsewhere. But my initial question is why so matches happening at zero location in the final sam file? it is a very strange behavior! ...
written 11 hours ago by Shelle0
0
votes
0
answers
212
views
0
answers
Comment: C: Alignment with BWA and SAMtools
... Hi finswimmer, sorry i really didn't get what you said. "NZ_PNFW01000001.1" and "NZ_PNFW01000010.1" are just different. Plus As i mentioned before, this problem still exists assuming i separated the largest strain for the reference so it is not multi sequence at all and there is only one sequence i ...
written 3 days ago by Shelle0
0
votes
0
answers
212
views
0
answers
Comment: C: Alignment with BWA and SAMtools
... Hi finswimmer The ref was multi sequence but i did separate the largest strain and ran bwa and got the sam file at the final stage which i also shared with you. i also checked the name of sequences and their name is different. I am putting two of them randomly in here: >NZ_PNFW01000001.1 La ...
written 4 days ago by Shelle0
0
votes
0
answers
212
views
0
answers
Comment: C: Alignment with BWA and SAMtools
... Hi finswimmer Below is part of the very last sam file that i am getting. I can't post all of it as it is a huge file. SOLEXA3_0008:5:100:15178:17570 73 NZ_PNFW01000001.1 1 60 20S80M = 1 0 CAGAAATAGATCAAGAGCCTAAAAAGAAAAGAGCTGGAAGAAAATATATTCCGCCAATGTC ...
written 7 days ago by Shelle0 • updated 5 days ago by finswimmer4.4k
0
votes
0
answers
212
views
0
answers
Comment: C: Alignment with BWA and SAMtools
... Thanks for raising some questions. I will go back and answer these questions. But my initial question was why i have so many matches at zero locations? i can not find any relation between 4% mapped reads and so many matches at zero location. Maybe i have lack of knowledge that's why i am asking! ...
written 7 days ago by Shelle0
0
votes
0
answers
212
views
0
answers
Comment: C: Alignment with BWA and SAMtools
... Ok so thanks for your comment. I have used the whole name for each file in bash. I just summarized it here. Sorry for the confusion. I just did this `samtools view sortedbam.bam -o sorted.sam` since i wanted to work with sam file later on. And sorry i haven't used this command `samtools flagst ...
written 7 days ago by Shelle0
0
votes
0
answers
212
views
0
answers
Comment: A: Alignment with BWA and SAMtools
... Hi finswimmer bwa index ref.fa bwa mem ref.fa read1.fq read2.fq > .sam samtools view -S -b .sam -o .bam samtools sort .bam sortedbam samtools index sortedbam.bam samtools view sortedbam.bam -o sorted.sam I looked at the "POS" field of "sorted.sam" file and not ...
written 7 days ago by Shelle0
0
votes
0
answers
212
views
0
answers
Alignment with BWA and SAMtools
... I am new to BWA and samtools and would appreciate any help regarding my question. With BWA i did alignment for a fastq file along with the reference. The output of BWA was given to SAMtools to process with commands like view, sort, index and again view to see the sam file at the end. reviewing sam ...
samtools sam-file bwa written 7 days ago by Shelle0
0
votes
2
answers
128
views
2
answers
Comment: C: Separate the Longest Strain in Bacteria
... @doctor.dee005 thanks for your response. This command only lists the length of sequences. How can i actually extract the longest strain and put it in a separate fasta file? ...
written 23 days ago by Shelle0
0
votes
2
answers
128
views
2
answers
Separate the Longest Strain in Bacteria
... I have a FASTA file of bacteria which has multiple strains like below. I would like to go through the FASTA file and extract/separate the largest strain from the FASTA file. Does anyone help me how i can do that? >NZ_PKKG01000001.1 Lactobacillus crispatus strain UMB1398 .21837_8_80.1, whole ...
genome sequence written 23 days ago by Shelle0 • updated 23 days ago by doctor.dee005120

Latest awards to Shelle

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 580 users visited in the last hour