User: ashaneev07

gravatar for ashaneev07
ashaneev070
Reputation:
0
Status:
New User
Last seen:
1 day, 5 hours ago
Joined:
7 months, 2 weeks ago
Email:
a*********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by ashaneev07

<prev • 33 results • page 1 of 4 • next >
0
votes
1
answer
150
views
1
answers
Comment: C: Increase memory limit in SPAdes-3.6.1
... hi... I'm sorry to inform u that, it didn't generate the output files like contigs.fa, scaffolds.fa,etc. It only created the files from the run with different Kmer values and warning logs. ...
written 12 days ago by ashaneev070
0
votes
1
answer
150
views
1
answers
Comment: C: Increase memory limit in SPAdes-3.6.1
... Thanks for your replay. I limited my inputs and once again ran the program. Now, its finished the pipeline but shows warning messages. I've pasted the command and the warning messeges that i've got. ./spades.py --pe1-1 /media/chloroplast_reads/300BP_R1.fastq --pe1-2 /media/chloroplast_read ...
written 13 days ago by ashaneev070
0
votes
1
answer
150
views
1
answers
Comment: C: Increase memory limit in SPAdes-3.6.1
... ./spades.py --pe1-1 /media/chloroplast_reads/300BP_R1.fastq --pe1-2 /media/chloroplast_reads/300BP_R2.fastq --pe2-1 /media/chloroplast_reads/500BP_R1.fastq --pe2-2 /media/chloroplast_reads/500BP_R2.fastq --pe3-1 /media/chloroplast_reads/800BP_R1.fastq --pe3-2 /media/chloroplast_reads/8 ...
written 14 days ago by ashaneev070
4
votes
1
answer
150
views
1
answer
Increase memory limit in SPAdes-3.6.1
... Hiii... i'm getting the following error while running SPAdes-3.6.1-linux. vailable memory limit. Increase memory limit and restart == Error == system call for: "['/home/Documents/TZ/SPAdes-3.6.1-Linux/bin/hammer', '/home/Documents/TZ/SPAdes-3.6.1-Linux/bin/trichochloroassembly ...
hybrid assembly next-gen alignment spades written 14 days ago by ashaneev070 • updated 14 days ago by Buffo1.3k
0
votes
3
answers
294
views
3
answers
Comment: C: Perl#replace a sequence name in fasta file with another name
... Thank you.. Glad to know about the perl one-liner.. :) ...
written 3 months ago by ashaneev070
0
votes
3
answers
294
views
3
answers
Comment: C: Perl#replace a sequence name in fasta file with another name
... Thankyou so much..your script works perfectly. ;) Even though i've merged the multifasta sequence as single sequence,then my program also worked nicely. ...
written 3 months ago by ashaneev070
0
votes
3
answers
294
views
3
answers
Comment: C: Perl#replace a sequence name in fasta file with another name
... Here with the example of my input file.. >lcl|NC_033621.1_cds_XP_020098752.1_1 [gene=LOC109717392] [db_xref=GeneID:109717392] [protein=ervatamin-B-like] [protein_id=XP_020098752.1] [location=join(31068..31412,32757..32880,32987..33597)] [gbkey=CDS] ATGGTTGCCACTAAGTTGATGATGACCTCT ...
written 3 months ago by ashaneev070
0
votes
3
answers
294
views
3
answers
Comment: C: Perl#replace a sequence name in fasta file with another name
... Hii.. I'm a beginner in Perl scripting and scripting in general.Also i'm not familiar with bioperl modules. that's why.. ...
written 3 months ago by ashaneev070
0
votes
3
answers
294
views
3
answers
Comment: C: Perl#replace a sequence name in fasta file with another name
... Thanks a lot... Please help me on my program ...
written 3 months ago by ashaneev070
6
votes
3
answers
294
views
6 follow
3
answers
Perl#replace a sequence name in fasta file with another name
... i want to replace name of the sequences in fasta file after '>' sign with the protein id within the header line.i wrote a perl script but it only prints the firstline of the sequence itself(given below). >XP_020088267.1 ATGGCTGATGCTGAGGATATTCAGCCACTCGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGG ...
sequence written 3 months ago by ashaneev070 • updated 3 months ago by JC7.6k

Latest awards to ashaneev07

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2502 users visited in the last hour