Moderator: JC

gravatar for JC
JC7.0k
Reputation:
6,970
Status:
Trusted
Location:
Mexico
Website:
http://about.me/jcabal...
Scholar ID:
Google Scholar Page
Last seen:
1 day, 20 hours ago
Joined:
6 years, 7 months ago
Email:
j*******************@gmail.com

Computational Biologist

Posts by JC

<prev • 605 results • page 1 of 61 • next >
0
votes
0
answers
102
views
0
answers
Comment: C: Are my methods correct?
... This looks like a homework or a bioinformatics test. Anyway, you can use EdgeR from Bioconductor for all. http://bioconductor.org/packages/release/bioc/html/edgeR.html ...
written 1 day ago by JC7.0k
1
vote
2
answers
139
views
2
answers
Answer: A: Counting base and nucleotide frequency of multifasta file
... It can be done with Perl: #!/usr/bin/perl use strict; use warnings; my %seqs; $/ = "\n>"; # read fasta by sequence, not by lines while (<>) { s/>//g; my ($seq_id, @seq) = split (/\n/, $_); my $seq = uc(join "", @seq); # rebu ...
written 2 days ago by JC7.0k
2
votes
1
answer
130
views
1
answers
Answer: A: RNA-seq data analysis for differential expression of a single gene
... Your major problem will be uncertainness of reads mapped to more than one location in the genome/transcriptome, definitively you need to align to the genome or transcriptome to remove non-unique reads or apply some strategy to decide origin. Kallisto, Sleuth or Salmon are fast enough to create your ...
written 5 days ago by JC7.0k
1
vote
1
answer
71
views
1
answers
Answer: A: How to handle RNASeq reads that can map to both human and mouse ref (e.g. conser
... Checking the coordinates for your first pair seems like the human hit is more reliable because it is at the end of a gene, meanwhile the mouse coordinates are in an intergenic region. So, you can filter if the hit clearly comes from a possible expressed region. ...
written 12 days ago by JC7.0k
2
votes
3
answers
199
views
3
answers
Answer: A: Perl#replace a sequence name in fasta file with another name
... That can be done using a Perl-one-liner: $ perl -lne '(m/>.+\[protein_id=(.+?)\]/) ? print ">$1" : print $_' < seqs.fa >XP_020098752.1 ATGGTTGCCACTAAGTTGATGATGACCTCTTTAATCTTAGTTCAACTGTGGGTGCTTATGCCACTGATGGCGTGTGGTAC AACGTTAGATCCCATGAGAGAGAGGTATGAACAATGGATTAGCCGATATAGCCGA ...
written 13 days ago by JC7.0k
0
votes
3
answers
199
views
3
answers
Comment: C: Perl#replace a sequence name in fasta file with another name
... An example of your input file and how do you want the output could be helpful. BTW I proficient in Perl and Python, still using primarily Perl ;) ...
written 16 days ago by JC7.0k
0
votes
2
answers
212
views
2
answers
Answer: A: How to match a FASTA header for extraction using Perl?
... The **\w** in Perl matches any alphanumeric char and the underscore, and using **(\w+)** should match any word and stop to the first no-word char (space or new line). If you want to save this in a hash: #!/usr/bin/perl use strict; use warnings; my %species = (); while ...
written 16 days ago by JC7.0k
0
votes
4
answers
267
views
4
answers
Comment: C: help identifying bioinformatics operations tools
... Hi, you can get access and more information here https://www.databiology.com/index.php/signup ...
written 17 days ago by JC7.0k
1
vote
4
answers
267
views
4
answers
Answer: A: help identifying bioinformatics operations tools
... We cover all of that in our platform https://www.databiology.com/ let me know if you want to know more or a demo ...
written 18 days ago by JC7.0k
0
votes
1
answer
25
views
1
answers
Comment: C: Perl-Genome Assembly with K-mer
... This looks like your homework or a school project, if that's true, at least try to code something or this will be closed/deleted. ...
written 4 weeks ago by JC7.0k

Latest awards to JC

Scholar 5 days ago, created an answer that has been accepted. For A: Best way to remove contaminants to get nuclear genome
Teacher 24 days ago, created an answer with at least 3 up-votes. For A: What Do The Period . Symbols Mean In The Sequence Record Of A Fastq File
Teacher 4 weeks ago, created an answer with at least 3 up-votes. For A: What Do The Period . Symbols Mean In The Sequence Record Of A Fastq File
Scholar 4 weeks ago, created an answer that has been accepted. For A: Best way to remove contaminants to get nuclear genome
Teacher 12 weeks ago, created an answer with at least 3 up-votes. For A: What Do The Period . Symbols Mean In The Sequence Record Of A Fastq File
Scholar 4 months ago, created an answer that has been accepted. For A: Best way to remove contaminants to get nuclear genome
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: What Do The Period . Symbols Mean In The Sequence Record Of A Fastq File
Commentator 4 months ago, created a comment with at least 3 up-votes. For C: What Should I Use Blat For?
Commentator 5 months ago, created a comment with at least 3 up-votes. For C: What Should I Use Blat For?
Scholar 6 months ago, created an answer that has been accepted. For A: Best way to remove contaminants to get nuclear genome
Teacher 6 months ago, created an answer with at least 3 up-votes. For A: What Do The Period . Symbols Mean In The Sequence Record Of A Fastq File
Scholar 6 months ago, created an answer that has been accepted. For A: Best way to remove contaminants to get nuclear genome
Scholar 6 months ago, created an answer that has been accepted. For A: Best way to remove contaminants to get nuclear genome
Scholar 8 months ago, created an answer that has been accepted. For A: Best way to remove contaminants to get nuclear genome
Teacher 8 months ago, created an answer with at least 3 up-votes. For A: What Do The Period . Symbols Mean In The Sequence Record Of A Fastq File
Appreciated 8 months ago, created a post with more than 5 votes. For A: Programming Challenge - Synthetic Whole Genome Vcf
Popular Question 9 months ago, created a question with more than 1,000 views. For Bioinformatician, Cellnetix Pathology And Laboratories, Seattle, Wa
Teacher 9 months ago, created an answer with at least 3 up-votes. For A: What Do The Period . Symbols Mean In The Sequence Record Of A Fastq File
Scholar 10 months ago, created an answer that has been accepted. For A: Best way to remove contaminants to get nuclear genome
Scholar 12 months ago, created an answer that has been accepted. For A: Best way to remove contaminants to get nuclear genome
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: What Do The Period . Symbols Mean In The Sequence Record Of A Fastq File
Scholar 13 months ago, created an answer that has been accepted. For A: Best way to remove contaminants to get nuclear genome
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: What Do The Period . Symbols Mean In The Sequence Record Of A Fastq File
Teacher 14 months ago, created an answer with at least 3 up-votes. For A: What Do The Period . Symbols Mean In The Sequence Record Of A Fastq File
Commentator 15 months ago, created a comment with at least 3 up-votes. For C: What Should I Use Blat For?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 948 users visited in the last hour