User: bison100

gravatar for bison100
bison1000
Reputation:
0
Status:
New User
Last seen:
7 months, 1 week ago
Joined:
10 months, 1 week ago
Email:
b*******@hhu.de

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by bison100

<prev • 9 results • page 1 of 1 • next >
0
votes
1
answer
2.6k
views
1
answers
Comment: A: How To Retrieve Data From Jgi Automatically Given A Set Of Ids?
... Hi glarue, I have read the script "jgi-query.py" from https://github.com/glarue/jgi-query, but I don't understand it yet. I want to download metagenomes from JGI using API. Does your script work for downloading metagenomes from JGI? Best, Bing ...
written 8 months ago by bison1000
0
votes
3
answers
3.1k
views
3
answers
Comment: C: Retrieve Mrna Seq From Ncbi Given A List Of Protein Accessions
... Hi Neilfws, For your second step---elink. I can't get anything other than below. protein 363743782 I input this, https://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=protein&db=nuccore&%20&linkname=protein_nuccore_mrna&id=363743782 ...
written 10 months ago by bison1000
0
votes
6
answers
46k
views
6
answers
Comment: C: Retrieve The Fasta Nucleic Sequences Of A List Of Ncbi Accession Number Of Prote
... Finally, input this. https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=109 ...
written 10 months ago by bison1000
0
votes
6
answers
46k
views
6
answers
Comment: C: Retrieve The Fasta Nucleic Sequences Of A List Of Ncbi Accession Number Of Prote
... Then input this site. https://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=protein&db=nuccore&id=110 145558928 ---to get protein coding mrna id : nuccore protein_nuccore_mrna 109 ...
written 10 months ago by bison1000
0
votes
6
answers
46k
views
6
answers
Comment: C: Retrieve The Fasta Nucleic Sequences Of A List Of Ncbi Accession Number Of Prote
... At first, input this website. https://eutils.ncbi.nlm.nih.gov/entrez/eutils/esearch.fcgi?db=protein&term=A3DH67 ---to get protein id : 110 145558928 ...
written 10 months ago by bison1000
0
votes
6
answers
46k
views
6
answers
Comment: C: Retrieve The Fasta Nucleic Sequences Of A List Of Ncbi Accession Number Of Prote
... Hi Michael, At first, thank you for your reply! Below is the way I have tried until now, which doesn't work well. Protein seq ---> Nucleotide seq: Finally, I always get, >X17019.1 B.taurus mRNA for delta subunit of ATP synthase GGAGTGAGCTCGCCTCTGCGTCGCCTTCCGCTGTCCGCCAGCCGTCATGCTCCCCTCCGCGTTG ...
written 10 months ago by bison1000
0
votes
6
answers
46k
views
6
answers
Comment: C: Retrieve The Fasta Nucleic Sequences Of A List Of Ncbi Accession Number Of Prote
... Hi Samad, Have you retrieved the The Fasta Nucleic Sequences Of A List Of Ncbi Accession Number Of Proteins successfully finally? If yes, could you please share your successful experience to us? Now, I also want to get the nucleotide sequence for each protein gene accession number? I used the searc ...
written 10 months ago by bison1000
0
votes
1
answer
3.6k
views
1
answers
Comment: C: how to convert NCBI protein ID to corresponding nucleotide sequence
... I also want to get the corresponding nucleotide sequence for each protein sequence from NCBI, because Uniprot doesn't provide this service now. ...
written 10 months ago by bison1000
0
votes
1
answer
3.6k
views
1
answers
Comment: C: how to convert NCBI protein ID to corresponding nucleotide sequence
... Hi David, I tried your code, but it always for the last step, it also gives me "protein 110 1209747831 nuccore protein_nuccore 109 nuccore protein_nuccore_cds 109 nuccore protein_nuccore_mrna 109", even if I have input different protein accession numbers. So, does it mean that I input something wro ...
written 10 months ago by bison1000

Latest awards to bison100

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1719 users visited in the last hour